For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:89559872-89559989 118bp GACCCATCTACAGCTTGAGGA AAGCTTTCTACAACACATTCTCATT
Mutant= 108 bp
Wild Type = 118 bp
Sequence
Wt Sequence (deletions in lower case):
CACACATACTATCCATTAAAATAAATAAAAAATTCTTTCTTGTTGGAGATGTAGTTCAGTGATAGAATGttttattagcacaaacaagactctaggggcttatccccagaacttcaaaagtaaaaagaaaaaaatatttttctcttttaaggtaactgaactgcacaacatcaaaaatataaccagactgcctcgagagacaaagaagcatgcagtggcaattatctttcatgacgaaacgtcaaagacatttgcttgtgagtcaggtaagcaatttcagacccatctacagcttgaggaaattgagttgcttcagagacaatgactcacacagatgaagacaaaggaagtctgaatagggtgGCATATTGTAATGAGAATGTGTTGTAGAAAGCTTTGTAAGAAGTTCAACATACTGATATGCTGTAGAAACAAATGTTTTTGCATTTC
This is a 294 bp deletion beginning at Chromosome 18 position 89,559,906 bp and ending after 89,560,199 bp (GRCm38/mm10). There is a 5 bp insertion (GGTAG) 106 bp before the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46702 | GAC CCA TCT ACA GCT TGA GGA | Wild type Forward | A | |||
| 46703 | AAG CTT TCT ACA ACA CAT TCT CAT T | Common | A | |||
| 46704 | TGT AGC ACA CAT ACT ATC CAT TAA AA | Mutant Forward | A | |||
| 46705 | Fluorophore-1 | GAC AAT GAC TCA CAC AGA TGA AGA C | Quencher-1 | WT Probe | ||
| 46706 | Fluorophore-2 | TGT AGT TCA GTG ATA GAA TGG CAT ATT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46702 | 0.40 uM |
| 46703 | 0.40 uM |
| 46704 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.