For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:95752770+95752878 109bp TGGTCTTGTGCCATGAATCT CACACTAGCAGGACAAGCAGA
Mutant= 91 bp
Wild Type = 109 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
AAAATAGAACATACAGAGGTTAGTGTTGGAAGATGAACTGCATGCAGGAATCGTTTTTGTTAGGATTCTGGTCTTGTGCCATGAATCTAAAGTAGATCCATTTCCTCtgccaggaggtaggatggcctcctgaagcctcagtaaataaagattctttctgcttgtcctgctagtgtgtttcctgtaacaaatccttcaagaaactctggtcccttcatgaacatatcaagattgtccatggatatgcagaaaaaaaatttgcctgtgaaatttgcgagaagaagttctataccatggctcatgtacgaaaacacatggttggtgagtctccgcccctctttctccacctgcagactcctggagtgctctctgctccacatTGGGCAGGATATGCAGAGTCAGCATACTGCAGTCAGTTTTAGCTTGTTGAGACTATATGTAGCTTGTCTTTAGTAAGCATGATCAGGTTGGACAGTGCAGTCTTCCCTACCCAGAGT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCATCCTACCTCCTGGCAG and AGTGCTCTCTGCTCCACATT, which resulted in a 273 bp deletion beginning at Chromosome 11 position 95,752,809 bp and ending after 95,753,081 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000674206 (exon 2) and 125 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 299 and early truncation 54 amino acids later.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46673 | TGG TCT TGT GCC ATG AAT CT | Common | A | |||
| 46674 | CAC ACT AGC AGG ACA AGC AGA | Wild type Reverse | A | |||
| 46675 | TCT CAA CAA GCT AAA ACT GAC TGC | Mutant Reverse | A | |||
| 46676 | Fluorophore-1 | ATG GCC TCC TGA AGC CTC | Quencher-1 | WT Probe | ||
| 46677 | Fluorophore-2 | CAT TTC CTC TGG GCA GGA TAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46673 | 0.40 uM |
| 46674 | 0.40 uM |
| 46675 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.