For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:87631686+87631788 103bp CCAGGTAAGATTCCTGCACA CAGAAAACTAAGCCCACAAACC
Mutant= 97 bp
Wild Type = 103 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
GAGACCCTGTCTCAAAACAACAAAAGAGAAATTATAAAGATAGACATAACCTTTTAAAAATTGATTACAGCAGTTATAGTACACACATTTGCAAACCTAGCTCAAGAGGGAGGGAGAGTGCTAAGTGGGTAACAGGCGCTCAAGGCTAGTCAGGGATAGACACCAAGatcttgtacgtttattataggccagagttttctaaaagcaattgaaagcacccaaatgtgtgcacacgtgtgtgtgtgtgtgtgcacgtgtgtgtgtgtgcgtgtgcgcgtgtgtgtgcacacgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtatgcatgtatacatgaagacagctacctctgtgctgtatcttacttggttgacggctgtttgtgtttggatgtgttccagctgtgctgcagtgctgctctcctcccacccacatggacgccctcagcagctgtgtcactcctactgcctcttcctatgcacactgtaattacttccaggtaagattcctgcacacgctgtgcttcacagtaataggaatctggcagattttcaaagtagaagccaaagATAGCTGGGTTTGTGGGCTTAGTTTTCTGAGTTCTAAGTGAAAGAAAAGAGGGTTGATGTAAATGATGCTAGAGTATT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAATAAACGTACAAGATCT and AGTAGAAGCCAAAGATAGCT, which resulted in a 401 bp deletion beginning at Chromosome 11 position 87,631,359 bp and ending after 87,631,759 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000586323 (exon 3) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 336 and early truncation 10 amino acids later.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46658 | CCA GGT AAG ATT CCT GCA CA | Wild type Forward | A | |||
| 46659 | CAG AAA ACT AAG CCC ACA AAC C | Common | A | |||
| 46660 | GCT CAA GAG GGA GGG AGA GT | Mutant Forward | A | |||
| 46661 | Fluorophore-1 | TGG GTA ACA GGC GCT CAA | Quencher-1 | MUT Probe | ||
| 46662 | Fluorophore-2 | CTG TGC TTC ACA GTA ATA GGA ATC TG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46658 | 0.40 uM |
| 46659 | 0.40 uM |
| 46660 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.