For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:21358632+21358731 100bp TCAATAACCAGGAAGGTGTCG CGAATGCAGCTGAGAAACAG
Mutant= 149 bp
Wild Type = 100 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
ATATTTTAAATAATGATTGAAACAAAATAACATAATTTATAAGAACATATGTTAAAGGGATAGACAAGATGgctgaggagttaagggtgcattctgaattatccagccatccacattgaaaatctcaataaccaggaaggtgtcgatattagataagagactattaagtagtaatttaatttatctgataaataaattgtctctctgtttctcagctgcattcggacttggataaaggagagggcactgttaaatacacgctctccggagatggtgctggcactgtttttacaattgatgaaactacaggagacattcatgcaataagaagcctggatagagaagaaaaacctttctacactcttcgtgctcaggcagtggacatagaaaccaggaagccactggagcctgaatcagagttcatcattaaagtgcaggatattaatgacaatgaaccaaagtttttggatggaccttatgttgctagtgttccagaaatgtctcctgtgggtgagtacacaaatcaaatttctatcagatgctattaaccaacagactgcattttcttggtacattttggtgtagatatcttatttataagatatcaatattgttcatttataaaatgttaatatgctctagaaactgtttcctctttctagaatacagacattagaatatgtgcctttttattatttcctaatttattgatttacttgaaataaccatatattatTCAATCAATGATGGAGATAACTATATACCAAATACCGCTGAAAACTATATAGTAATTCTTAGCTCAAATTAAAGTAT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGGATAGACAAGATGGCTG and ATCATTGATTGAATAATATA, which resulted in a 665 bp deletion beginning at Chromosome 15 position 21,358,579 bp and ending after 21,359,243 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340213 (exon 3) and 370 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 6 amino acids later.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46652 | TCA ATA ACC AGG AAG GTG TCG | Wild type Forward | A | |||
| 46653 | CGA ATG CAG CTG AGA AAC AG | Wild type Reverse | A | |||
| 46654 | CAA ACA TCT ATT CTC AAA GAA GCA GT | Mutant Forward | A | |||
| 46655 | TAG TTT TCA GCG GTA TTT GGT AT | Mutant Reverse | A | |||
| 46656 | Fluorophore-1 | AGA TAA GAG ACT ATT AAG TAG TAA TTT AAT TTA TCT GAT | Quencher-1 | WT Probe | ||
| 46657 | Fluorophore-2 | ATA GAC AAG ATG TCA ATC AAT GAT GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46652 | 0.40 uM |
| 46653 | 0.40 uM |
| 46654 | 0.40 uM |
| 46655 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.