For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:45261370+45261473 104bp GCTACAAGCCCTGTTCCTTC CTCGGTTAGCACGTCAGTTCT
Mutant= 110 bp
Wild Type = 104 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
TGACGTCTCTGAGATGTGAGAGCAGGATAGAAAGCAGGAGTCCGAGCACCCAGGGTCTGGGAAAGTGGAGGTCAGGGTTTTGAGCATAACTCGGTGGGTTGGCCAGGCAGGATGTTGGTGGGGAAGGGCAATGACCAGGCGTCTGAGACTCCTAGAAGTAAGAAGGTTGGCCAGTGacggatgcggggcagtcaagccttaaccttgtggcctgagtgagggtgctgctggtgagcagtcttcctagttgcataaagaaggacagacatgagccgaggctctcggaacccttctgccttctctccacaggcagcttctttatagcgtacatcttgatgctgttgggcattgggattccacttctcttcctggagatggcagttggtcagagggcacagcagagcagtgcggacatgtggaagaacctgagcccctggtttggtggagtggggtacagcatggttatggtgaggagccccaggcttcacaaacctgcctgccccacagtgctcctctccctcccctctggagaaaatcccacggctgccctggtgtggaccatgctccttcagcccctccaaactttgtcagtcccttctctctccctgtccctggtcttcctccccagtcatgtctccactggcctgcaggtgtgcttcatcaccaacacctacctgaacgtgttcaattcttggatcctcttctacatgagccacatattctactttgttgtcccatgggaccagtgtcccttacaaaggaattccagtaactttggtgaggaaggagacgtgggagaatgaagggacttgggaagaggaggagagaggagggaggggcacgaagagaaagacaggagaggagggaggcagggggttggggcttgccttatctagcaggcctgtccaaagccatgttcccccagatcctgaatgtgaacaggcaacatcctacacgtacttttggtaccggaagaccttgaaagcctcagacagaattgaggatggagggcaaccgtccttcagcctgggcatgtctctctttctgtccttctgtctcatttgtgctttcttggtcaatgggatcaagtccattgggaaggtgagctgcacttggcccttggcattctcaagtgctacgaccttgttttctccttcctggccagttatccccaaaagctttttttccgagtcctcgtccagcccccttagctctacaaagctgagtcgcttgacaagcagctgatgtgctgccctccccttgtaggtcctgtttgtcttgctactggttccctattccatcatcgtctgcttcctcatccggactctgtcgatggacggcgcagaatacgggcttaagcacctgctgatcctcaaggtgaggttcttcctgggttccctgagctctgggaccagcacggctgcctgctgttgtctcccgtacctcctcctttcccttccctctcatagttgttctctcccaggtcctgatgtccctattgtacctgtcttctcctttttaggtggcgagcatctctgacttaactatttggtgccatgcaggtatccaggtcttgtttgatatcggcctgggctttggccccattgtctccttagcctcacacgtacccgacttcaacaactgtatggccgatgccttcttaatggctctgttcaagataatcaccttactgatgaccacacccttcctcctctccatcctgggcttctgggccactacaactacacatcactgctgtaagaagtaaggccagtccctggcaggtcacaacccattcacacaccttacccgcagggaggctacaagccctgttccttcttatctgagagcagagccccttcctaacattagaaagctccagAGGTCGTCAGGCCGCACCTCAGAACTGACGTGCTAACCGAGGCCAAGAGTGGTAGGGAGGCAAAGGTCACCCCGGCACAGAGA
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGCCAGTGACGGATGCG and CTAACATTAGAAAGCTCCAG, which resulted in a 1706 bp deletion beginning at Chromosome 7 position 45,259,727 bp and ending after 45,261,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001034222 and ENSMUSE00000967546 (exons 4 and 8) and 892 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 160.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46343 | GCT ACA AGC CCT GTT CCT TC | Wild type Forward | A | |||
| 46344 | CTC GGT TAG CAC GTC AGT TCT | Common | A | |||
| 46345 | CAG GAT GTT GGT GGG GAA G | Mutant Forward | A | |||
| 46347 | Fluorophore-1 | AGA GCA GAG CCC CTT CCT AA | Quencher-1 | WT Probe | ||
| 46350 | Fluorophore-2 | TTG GCC AGT GAG GTC GTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46343 | 0.40 uM |
| 46344 | 0.40 uM |
| 46345 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.