For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:35841020+35841129 110bp CAACCACATCCCAGAAGTCC GCAGGGCTGAGTCATAGCA
Mutant= 103 bp
Wild Type = 110 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
TAGGGAGGATGCAGATGTGGTCCTTCAACCACATCCCAGAAGTCCTAGCACCaaggaggggtcagatggactggaaggctgggaatccaatgggcccatactagggccaagggtcttgctatgactcagccctgcctcactgtccagatgtgctctgtttatgcttgaagagcctgttagggttatgttgtttctgcccctgagatctagagggcaaatacagtgggcttggtgaagggcaagccgtgctcctgacccaggttttctcacactgtcttcctaccagggggatcaggatgatcggtcctacaagcagtgcaggacctccagccccagctctgccggctcagtcagcctcggacactacaccccaacctcacggtcaccccagcactacagtcgtccaggtattcacccccaccccactcaccttgacccccgtgaggttgtacttctccatgagtttcctgatacaaagtagcttctttattcattgagaaaagtggaaagggagggtggggggtggtgccggtggggccatggaatgtctggccacttagacatatgggaaagactgcctcaagcctgggagcaggcaaccataAGGCAGCTAGTCACCCTGGGGCTGGAGGAGGTGTCTGAATCCACAGTGCCCATCCCGAGACACACACAGCCCCAAGCTCCACACAGAACAACCAGAGTGGGCTTCTGGGGGCAGTTACAGAGCTGTCAGATGTGAAATTACACACGAGGTAGGAGAGCAAAGCAAGCCACAGTCTGTTGGGAGTCCAT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGTCCTAGCACCAAGGAG and CCTGGGAGCAGGCAACCATA, which resulted in a 552 bp deletion beginning at Chromosome 5 position 35,841,047 bp and ending after 35,841,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185461 (exon 11) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 350 and early truncation 37 amino acids later
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46327 | CAA CCA CAT CCC AGA AGT CC | Common | A | |||
| 46328 | GCA GGG CTG AGT CAT AGC A | Wild type Reverse | A | |||
| 46329 | CTT GGG GCT GTG TGT GTC T | Mutant Reverse | A | |||
| 46330 | Fluorophore-1 | CAG ATG GAC TGG AAG GCT G | Quencher-1 | WT Probe | ||
| 46331 | Fluorophore-2 | CAC CAG GCA GCT AGT CAC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46327 | 0.40 uM |
| 46328 | 0.40 uM |
| 46329 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.