For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:79736759-79736864 106bp GTACTGGGCACAGGCGTTAG AACTCTTCTGAACGGCTTGTAA
Mut= 112 bp
Wt= 106 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertions with carrots ^g^ (AATCATCTCA insertion):
CGCCGTGCTTTTCACTGGCTCTGTAGAGGCTTGAATGCTGTGTGTGTGAGGTAATGAGGTAAAAGTTGATGTGTGTCGGGAGTCAGGCCACTGATGGAGATATTTAAAGATGCTACACGTGTCTGCGAGTACTGGGCACAGGCGTTAGCTCTCACCCAT^tgtgtgtgctgatttatagtatcagatgatgatcagttctgtccagtgcactgttacaagccgttcagaagagtttaaataaagataaaatgaccaagcatctctctttctctctttctgtctccacagaaccatccgagtatggctgaaaagagacagcggccagtactggcccagcatctaccacacaatggcctgtaagtcctgggctttcccacttaagaccttgtttctgataccttggatgattgatatttttaaaagacctggctcaaaattgccactgaatttcagagtgagtgcctttgttgcccaagacctctgg^CAGGCTATCATAAACCACAGGAAACTCCCTTTGCAGAGGCAATTGGTCTACCAGCCTAACTGAAACAGGACCAAAACTGAAAAAGGACTAAAACAAAAAAGGAAAAGGACCATTTTCCTTTGTCCTAGTTTGTCCAGTTTAAACTCAGTAGTGACTTTATGAAAATGGT
This mutation is a 325 bp deletion beginning at Chromosome 1 position 79,739,934 bp and ending after 79,740,258 bp (GRCm38/mm10). In addition, there is a 10 bp (AATCATCTCA) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46149 | GTA CTG GGC ACA GGC GTT AG | Common | A | |||
| 46150 | AAC TCT TCT GAA CGG CTT GTA A | Wild type Reverse | A | |||
| 46151 | GTC CTG TTT CAG TTA GGC TGG T | Mutant Reverse | A | |||
| 46152 | Fluorophore-1 | ATG ATC AGT TCT GTC CAG TGC A | Quencher-1 | WT Probe | ||
| 46153 | Fluorophore-2 | CAT CTC ACA GGC TAT CAT AAA CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46149 | 0.40 uM |
| 46150 | 0.40 uM |
| 46151 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.