For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:26927006-26927115 110bp GGGAGCATCTAAAGCAGGTG AACAGGTCAGAGGAGACAAGC
Mut= 110 bp
Wt= 110 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGATAGTATTAGACATTGCCTATGGTCCTGTGCCAGATGTGTGTGACGCTGTCTTTGTCTCTGGGACTAAGTGTTGATCATCATGTGTCTAGACTTACGATGGGAGCATCTAAAGCAGGTGTTGAGTCCTGCAGTCTGCCCTGgcaaggcactggacctgctgagggcctctctgtcttccagagagctggcttgtctcctctgacctgttgtcatgatgaggttgcagccacctcaccagtgtgttctgtggtcttacagttccttcgagtcaccaagcagtacctgcctcatgtggcgcgcctctgcctgatcagcaccttcctggaggatggcatccgcatgtggttccagtggagtgagcagcgtgactatatcgacaccacctggagctgtggctacctgttggcctcatccttcgtgttcctcaacctgctgggacaattgagtaagtggctctctagcctctctagtatacttctggagcatcctgttcccttgactgatactccccattcattgttgttggccattgagaagctatgtgtgaacttgaggtctgggtaccccttcctgggctgaagGCTGATATGACAAACTTAAGAGCTTCTCAGCTGAGATTACAGCTCTGGGTGTTGAAATATGCCAGCCATGGTTTGGTTCTGAGCTTTTGGGTGGATGGTCCATACTCAGTTCCCTTGCACGCATTTCTTTAAACTTGCTCTAGAGATCGGAC
This mutation is a 441 bp deletion beginning at Chromosome 2 position 26,926,633 bp and ending after 26,927,073 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46105 | GGG AGC ATC TAA AGC AGG TG | Common | A | |||
| 46106 | AAC AGG TCA GAG GAG ACA AGC | Wild type Reverse | A | |||
| 46107 | TGG CTG GCA TAT TTC AAC AC | Mutant Reverse | A | |||
| 46108 | Fluorophore-1 | CAC TGG ACC TGC TGA GGG | Quencher-1 | WT Probe | ||
| 46109 | Fluorophore-2 | CCC TGG CTG ATA TGA CAA ACT TA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46105 | 0.40 uM |
| 46106 | 0.40 uM |
| 46107 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.