For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:92683100+92683210 111bp CAGGGAGTTTATTGTTTCTACTAGGG TTTCCCATAAGGAGGCACAC
Mutant= 100 bp
Wild Type = 111 bp
Sequence
GTCCAGCTAGAAACTCTAGCGGATAGGTTGTTCTTATTCAGTCTTGGTGCTGATTTGCACATGGCTGTTTTTACCATGCATTTGACTAAGACTGAACACTCACAGGCAGCTCCTCTCagcctagttctaacaggcaacttttgcatcttctctctcagattcccttttttgaagagttctgtaaaaagactcaagccggtggtgacgcctgtgagaacctggtagggtattctgcggtgtacagagtctgctttggaatggcttgtttctttgctctgttttgcctgctgaccttaaaagtcaacaacagcaaaagttgccgggcctacattcacaacgggtaagtctcttgttcttccaagggtgtcctagggtctgctcgtcctcactgactgacgttctgctagttgacatttgacactgatgtggggaggatgggctgtgtgtcactggtagcctaagagcggcagtgcctggtgccataataagaaattcagtatacacagggagtttattgtttctactagggtcttcccctgagtcatttccatcctaccgTGAAGAAGAGTTTTATACAATCAGAGGCCATTCCAAGTGTGCCTCCTTATGGGAAAAGCCACTCTGTGGCACTCCATCACTTCCCCTTGATGTGGGAAGAACACTACCAACAACAGAAACATGAGCTAGCAGGCGGCCTTACAAGGA
A 441 bp deletion beginning at Chromosome 13 position 92,682,714 bp and ending after 92,683,154 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45979 | CAG GGA GTT TAT TGT TTC TAC TAG GG | Wild type Forward | A | |||
| 45980 | TTT CCC ATA AGG AGG CAC AC | Common | A | |||
| 45981 | CCA TGC ATT TGA CTA AGA CTG AAC | Mutant Forward | A | |||
| 45982 | Fluorophore-1 | TCC CCT GAG TCA TTT CCA TC | Quencher-1 | WT Probe | ||
| 45983 | Fluorophore-2 | AGG CAG CTC CTC TCT GAA GAA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45979 | 0.40 uM |
| 45980 | 0.40 uM |
| 45981 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.