For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:116144083-116144188 106bp CCTGGGTTGAAAGCAGAGTG TCCAAGAGATGTGCCTCCTAC
Mut= 104 bp
Wt= 106 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCAGCCGTGTTACCTCGATTGGGGCTACTTTTCATCCAGAAAATATTTATTAGCTTCCTGCTGCGTGTCTAGTTGGTGCCAACACAGGGAGAAGGCACTGAGCTTTCTTTGAGGTCTTCAGTTCCAAATCCAGGATCACCTAGTCGAACGCCTCCAGGGCTAGAAGTTGTgtgcataccactcggtacctcgctcccccaactgcgcggcttttctgagcgttacggcgccctcctcctgttcccccaccccaccccccgcgcggggcgggcggggatccacgggtttcgctccgcgttcgtagcagagaagggaggacccttgggaaccggaccctggtcgcccagtcctgttctggcttgggcccacatggaggggaccgcggagtcccagacgccggacttgcgagacgtggagggcaaggtgggcaggaagatccctgaaggactgctccgcgggcttcgaggcgagtgcgagctgggaacctctggggacgtgctgctcccgggggcgcccagcaccggccacggcctaggggacaagatcatggcgctgaggatggagctggtgagtgtgggtgctacaggccacggggaacgggatatttgtaggggcaggggcaggttcccggagttgggctggagaagagggtccttccaagatcaatccatacatcctgggttgaaagcagagtgaagtgacgtctcattatttgtctcccaagggtgaatgaaggGTTGATAGGTCCTGAGAACTGAGAGTAGGAGGCACATCTCTTGGAAGTTTTCCCTGCCCAATAATCGGAAGGAGAGAGGCGAGGGCTAAGTAGCACACAAAAAAAACTTAGTACAGCGCAAATTCTTCCCATCGGCATCCGGGGCCACCAATTTCTTCAGACTCCACTATAAGGCAACCG
This mutation is a 566 bp deletion beginning at Chromosome 4 position 116,144,128 bp and ending after 116,144,693 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45721 | CCT GGG TTG AAA GCA GAG TG | Wild type Forward | A | |||
| 45722 | TCC AAG AGA TGT GCC TCC TAC | Common | A | |||
| 45723 | AGG TCT TCA GTT CCA AAT CCA | Mutant Forward | A | |||
| 45724 | Fluorophore-1 | TCT CCC AAG GGT GAA TGA AG | Quencher-1 | WT Probe | ||
| 45725 | Fluorophore-2 | AGG GCT AGA AGT TGT GTT GAT AGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45721 | 0.40 uM |
| 45722 | 0.40 uM |
| 45723 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.