For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:94867548-94867702 155bp ACACTCACCTTGGCCATTTG CAACAATGCTGCCCTGAAGT
Mut= 146 bp
Wt= 155 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGATAGGAAGCATTCCACAAATGTTCCTTCCATTACACAGAGCATCATAGAACAGCCCGATAGAGATGAACATCAACACTCACCTTGGCCATTTGGTTAGGGCTGCCCCTCTGTTGGCTGCTATCCTGTAGCTACCCTACCATCCtaaggttttctctaagctaggatccagggaagggtgtagtattgctccctcaggaggctggggtaacttcagggcagcattgttggggatcacggtccagcaacaatccgatcattagcttcttgacccacagatttaccggaggtgctggctggtgttccggaaatcttccagcaaggggccccagcggctggagaagtatcctgatgagaagtccgtgtgcctccgaggctgccccaaggttaggggcctgggtcctagatcccccaacctgtgagcaaagatgacttgctgagtcctgaggtctgagagtaccttcctggggaacccagctaaggaggtaaggtgaagtgccccggcctggctaaatctcttgggatatctttccaggtgactgagattagcaacgtcaagtgtgtcacacggctccccaaggagaccaagaggcaggcggtggccatcatattcacagacgactccgctcgcaccttcacttgtgactcaggtaaggccccaggactgcaggctccatctgctctcctcgggctggtcagtcagtggtctaggcagtgagtaccagagcaaggccaacccttgcagaaagagtgggagagctgtgcccttaGTGGAGTAGGTCGCAGACAGAGGTGGGCAAGGCAGGCAGCAAGGCCTTCCTGCATGGTGCAATGAGTCAACCCAGGGCAGATTAGGTGGGCTGCTGGGGCCTCTGAGCTGGCAGAACTATGAAGTGCTATTTTTTTCTAGAGCTGGAGGCAGAAGAGTGGTA
This mutation is a 625 bp deletion beginning at Chromosome 8 position 94,867,008 bp and ending after 94,867,632 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45585 | ACA CTC ACC TTG GCC ATT TG | Common | A | |||
| 45586 | CAA CAA TGC TGC CCT GAA GT | Wild type Reverse | A | |||
| 45587 | CCT GGG TTG ACT CAT TGC AC | Mutant Reverse | A | |||
| 45588 | Fluorophore-1 | AGC TAG GAT CCA GGG AAG GG | Quencher-1 | WT Probe | ||
| 45589 | Fluorophore-2 | CCA TCC GTG GAG TAG GTC G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45585 | 0.40 uM |
| 45586 | 0.40 uM |
| 45587 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.