For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:23517366-23517490 125bp CCAACATAAAGTGATGAGGATGTC AAGTGCATTAGGACCCTGGA
Mut= 122 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GACACACAGATCTACACACAGTCATACACACATATACAACACACACAGCATTATACACACAGTCATACACACAGTCACACACACAGAGTTACACACATACAAAGTTTCACACACACACACACCAACATAAAGTGATGAGGATGTCCTAGCCattattatttgtggtaatgtcgactaagatgtatggatttaaaaaaaaaaaaaaaaaaaaaactcttgatgattttccagggtcctaatgcactttttaaacatgggcttgccgatgaagcctagcattcttgtgcaaaagcagagtaaggaagagatggccacatccttaggagacaacatcaaggcagaagactaccaaaagaaacagacatatgagcctgtgaatgctagagaaaccaaccatgaggtgacatgttctctttcaggggttgctcagggtttaagtttgatcggggaggagagtcgccatgtgggcgtaattagatcataatggttccatgaggcactgtcagtctgcaggcttccactgttagctttcattcttacATTCCTGTTCATCTTACTATTTCTCCTTTGTTGTTTTTCTTATACTCCTGGGATCTTAGATCTATAAAAGTTCTTGCCACTTATCTAGGGCCTAAACTTTTGTCCCATGGAAAACTAAAGTGACTTGTGACCTTCCTATGGCCGCTAAACAAGCACTGTGTCCTTA
This mutation is a 389 bp deletion beginning at Chromosome 11 position 23,517,072 bp and ending after 23,517,460 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45537 | CCA ACA TAA AGT GAT GAG GAT GTC | Common | A | |||
| 45538 | AAG TGC ATT AGG ACC CTG GA | Wild type Reverse | A | |||
| 45539 | GGC CCT AGA TAA GTG GCA AG | Mutant Reverse | A | |||
| 45540 | Fluorophore-1 | TGG TAA TGT CGA CTA AGA TGT ATG GA | Quencher-1 | WT Probe | ||
| 45541 | Fluorophore-2 | TTT GTT GTT TTT CTT ATA CTC CTG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45537 | 0.40 uM |
| 45538 | 0.40 uM |
| 45539 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.