For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 89 bp
Wild Type = 120 bp
>chr2:69199149-69199268 120bp TGTGTGTGTTTGTGTGAGTGC AAGCCCGATGACCTGAGT
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
CTGGTCCTGACGTTGGCTGACCTTTACCTCAGATTCTCCTGCCCCCAGCTGGAAATGTTGGAATTAAAGTCTGCCTTTATGCTAGCTGAGTTGCTCAATTATTAACCATT[ctgtagcaaagtcaacctgcagacataaactcgaaaatgtggcttatttggtgtcgatagcaactaaaatacagctttgtgctctgttttgcagtgtcttaaaacataatgggtgaagacgaattggcactcttaaatcaaagcatcaatgaatttggggataagttcagaaacag... ...agtatcctgtctcttgtgcctaagatctgcctcaactgtcatttgactcataaggaaaattgtgtttgcacagctctttccatttcagtgtgtcttcttgaggtaacgacctctaaaggctgagagtgtaattttgccacatagatgtatttggggccctaataagtagcatctctcctgggtgacagaacttcctgggagctaaaactct^agctcccaggaagttctgtcacccaggagagatgctacttattagggccccaaatac^]GAGAACACAGTTCTTTGTATTTCCTGTGCAAATGTGATTACCCTAGAGAACTGGAAATGGTACTGTCAGCAGTTCATGGTTACTTTATGTAAAATAACCAATATGTAGTCATTTACTTTCC
Mutation details
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44562 | CCT TTA TGC TAG CTG AGT TGC TC | Mutant Forward | A | |||
| 44563 | TGT GTG TGT TTG TGT GAG TGC | Wild type Forward | A | |||
| 44564 | AAG CCC GAT GAC CTG AGT | Wild type Reverse | A | |||
| 44565 | Fluorophore-1 | CTC CCA GGA AGT TCT GTC ACC C | Quencher-1 | MUT Probe | ||
| 44566 | Fluorophore-2 | CAC CCT TGT GGA GGT CAA AGG T | Quencher-2 | WT Probe | ||
| 45430 | TGG GGC CCT AAT AAG TAG CA | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44562 | 0.40 uM |
| 44563 | 0.40 uM |
| 44564 | 0.40 uM |
| 45430 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.