For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:19397474-19397614 141bp GAAGGCAGAGGCATGCTA TGGAAAACAGGAAAGAGTTCTG
Mut= 139 bp
Wt= 141 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ACCTCAGAAATATACCAGTCCCTGAAGCCAGGCATGGTGGCGTGCCTTTAAGCCCAGCACCGTGAAGGCAGAGGCATGCTAGCCTAGTCTACATGGTGAGCCAGCCCCTGCCCTGAACAACAGAGAGCTACACAGGCAGGCCCGATGTAGctccagggcctcggcctgacacttgactttctcagaactctttcctgttttccacagaggcccgagtccccccctcgccgagacagcttggcatctctgttccccagtgaagaggaggaaaagaaaggtgggtgtgtgggagccctgggcacgatatcagagggtaaccacccaggactacaggttaagcctgggacaggaaccttgccctgagggacaccgaggcctctgaggaggggaagaagcaggtggccctggctagtagGGACATTGGAAGCTGGAAGACAGTCACGTTAGGTTCTGGCACCTAACATGCCACCGGCTGGTTAGATTTCTGAAATCCCTGTGTCCTGTCACCACATGACCGTACTCTAAGAGGTGGCTGTTGGGACCAGGCTGAGGCCCACTGTGGGTGAC
This mutation is a 265 bp deletion beginning at Chromosome 7 position 19,397,263 bp and ending after 19,397,527 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45415 | GAA GGC AGA GGC ATG CTA | Common | A | |||
| 45416 | TGG AAA ACA GGA AAG AGT TCT G | Wild type Reverse | A | |||
| 45417 | GGC ATG TTA GGT GCC AGA | Mutant Reverse | A | |||
| 45418 | Fluorophore-1 | CCT CGG CCT GAC ACT TGA | Quencher-1 | WT Probe | ||
| 45419 | Fluorophore-2 | CCG ATG TAG GGA CAT TGG AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45415 | 0.40 uM |
| 45416 | 0.40 uM |
| 45417 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.