For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:139429332+139429494 163bp AGGCAAGTATCCTGCTCCTG AAAAGGACAATCACAGTGCATC
Mut= 168 bp
Wt= 163 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (TTTTTTAG insertion):
TTAGAAATACCTGAATGAGTACTTTTTTTTTTTTTTTTAAACAACCTAAGCATTTGAGGGAAAGTATACTTTAAGCATTAAGCTCAAAGTGCTGGGTCTTTGAGGTTCATTTAGTTAGAAATTTAGGTAAGTAGTTTTCTCTTTAGTT^ccctatgtgaatttgggtatatatagtaaggttattaaatggtgccttttcattgcaatgcgaagtttccgtcaaagcagagcagatacgttgaactcaattttcttctctattgtagggaaatatgagagccacacccgtgtgcacacaggtgagaagccttttgagtgtgatatttgtcaccagcgttattcgacaaagtctaacttaactgttcacagaaagaagcacagtaacgaagtagagtttcataggaaggagcacaagtgcccttactgtaacaagctgcacgcaagcaagaagacactggccaagcacgtcaagaggcaagtatcctgctcctggcgtcacacaagtaacaaatgaccaaacaaaagcaaatggcagctcgttcatgttttttctcactgttgatgaggccctttggcagt^GCAACAAGTATATGGCTGATAATGTGAAGTTTAAGATGCACTGTGATTGTCCTTTTTTTTTTTTAAGATTTTTATTTATTATTATTCATTAGTACACTGTAGCTGTCTTCAGATGCACCAGAAGAGGGCGACAGATATCATTACGGGT
This mutation is a 431 bp deletion beginning at Chromosome 1 position 139,429,008 bp and ending after 139,429,438 bp (GRCm38/mm10) . In addition, there is an 8 bp insertion (CTAAAAAA) at the deletion site..
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44027 | AAA AGG ACA ATC ACA GTG CAT C | Common | A | |||
| 44029 | Fluorophore-1 | CTC ACT GTT GAT GAG GCC CT | Quencher-1 | WT Probe | ||
| 45397 | Fluorophore-2 | TGG GTC TTT GAG GTT CAT TTA GTT AG | Quencher-2 | MUT Probe | ||
| 45398 | CCT AAG CAT TTG AGG GAA AGT | Mutant Forward | A | |||
| 45399 | AGG CAA GTA TCC TGC TCC TG | Wild type Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44027 | 0.40 uM |
| 45398 | 0.40 uM |
| 45399 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.