For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:172376297+172376396 100bp GGTCTCGGTGATCAGCCCTA CCATACCCTGCTCATCTGC
Mut= 113 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGGCAGGTGTGAGGTCCTGGGTTGTCCTCAGCAGCACAGAATAAACCAAGTGTTGTTTTCCATTCTGAATGGGAAAGATGGAATAATGGCCACACTGCTGCTTGCGTTGCACTTTGTTGTCTGGTTAGAGcaagtgaatggctgtggaggcggaaatcccctttcccagcccactctgcccatggagtgcgcctcacatagcatggaatggacagggctcacgatccatccgctccaggatgggtctttgcatttacagatcttctcatgctcttctcttgattcctttagggatggagaacgatgacactgcggtccagtatgccattggtcgctctgacacggttgccccgggcacagggatcgacctggagtttgatgcagacgttcaaacaatgtcaccagaggcttccgagtatgaaacctgttatgtcacttcccacaaaggcccgtgccgcgtggccacctacagcagagacgggcagttgatagccacaggatctgctgatgcttccataaagatactggacacagaaagaatgttggccaaaagtgccatgccaattgaggtaccattcccgcctaccactgctccagacagcgtggctgtgttgtcaccagctctggtttgccccgtgggactgtgggcgtggatccatgcctctgtgccttgagcatctatctctccttttcttgttggtccaggtcatgatgaatgagactgcacaacagaacatggagaaccacccagtgatccgaactctttacgaccacgtggatgaagtcacgtgtcttgcttttcacccaacagaacagatcctggcctcgggctcaagggattatactctgaaattgttcgattattccaaaccgtctgcaaaaagagctttcaaatacattcaggttagacctaacaggagcacttgactttctgatacagtatttcaagtggtctcggtgatcagccctacctggtacttagataagatgccattgagGGGTCACTGGCTGTCCTTTGCCCAAGCAAGACTGCAGATGAGCAGGGTATGGTAGATCACACAGTAATCCCAACACTGAGGAGGTCTGCCACAAGTTCAAGGCTAACCTGCTGCATAGTCAACTCCTTGCCAGCTTGAACCA
This mutation is an 868 bp deletion beginning at Chromosome 2 position 172,375,477 bp and ending after 172,376,344 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45364 | GGT CTC GGT GAT CAG CCC TA | Wild type Forward | A | |||
| 45365 | CCA TAC CCT GCT CAT CTG C | Common | A | |||
| 45366 | TGG GAA AGA TGG AAT AAT GG | Mutant Forward | A | |||
| 45367 | Fluorophore-1 | CCT GGT ACT TAG ATA AGA TGC CAT T | Quencher-1 | WT Probe | ||
| 45368 | Fluorophore-2 | TTG TCT GGT TAG AGG GGT CAC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45364 | 0.40 uM |
| 45365 | 0.40 uM |
| 45366 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.