For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:145095934+145096041 108bp AGAAGGAGGGGAAGAAACCA AGCACAGGTCACTTGCTACG
Mutant= 93 bp
Wild Type = 108 bp
Sequence
wt sequence, deletion in lower case
CCTGGGCTTCTTAACACCGTGTGCCAAAAGAAAACACAAATTCCCAGTTCTGTTCTACCTGGCTTTGTAAGGATCCTGCGTCCTCTGGTGTCCTTAGGAGAGAAACAGCCTTGGTTTTGTATGAGATAATAACCATAGATAGGAGAAGGAGGGGAAGAAACCACTAAGCCCAcagttaccccatgcccagctgtcacccgccaatagcccagtcccttgccactggccaggcgtagcaagtgacctgtgcttcacttttaggtattgactgggctcctaagagcgaccgtattgtcacttgtggggcagaccgcaacgcctatgtctggagtcagaaagatggcatctggaagcccaccctggtgatcctgaggattaaccgtgcagccacttttgtgaagtggtccccacttgagaacaagtttgctgtggggagcggagcccggctcatctctgtctgttactttgagtctgagaatgactggtgagccaagttgcatgtgtcctctcactctgctttgtatactccatgctgggatgctgtgctcctgggacctgttgaggctctgtgtactgcagtgcccttcctggcctggagaggctttctccctctcaaCTCGTATGTGCATGACTCAGCTCCCATACCTTTTCTTTGACTCTTCACTTCCCTTCCTTACTCCTCTACTTCCTTTTGTCCATTACTTCCTCCCTACCCCTTCTTTCCCTTCCCTCCTTCAGCTCCTTCATTTCCTCCTTCCAGCTCCCGACTTATCTTAATTCACATGGGCAACA
A 444 bp deletion beginning at Chromosome 5 position 145,095,963 bp and ending after 145,096,406 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45117 | AGA AGG AGG GGA AGA AAC CA | Common | A | |||
| 45118 | AGC ACA GGT CAC TTG CTA CG | Wild type Reverse | A | |||
| 45119 | GGA GTA AGG AAG GGA AGT GAA GA | Mutant Reverse | A | |||
| 45120 | Fluorophore-1 | TTA CCC CAT GCC CAG CT | Quencher-1 | WT Probe | ||
| 45121 | Fluorophore-2 | TGC ATG ACT CAG CTC CCA TAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45117 | 0.40 uM |
| 45118 | 0.40 uM |
| 45119 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.