For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:78956995+78957098 104bp TGAAACTGAATGCTGGAGGA TTCAAGAAAGTCACCATGAGC
Mut= 119 bp
Wt= 104 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case, and insertion ^G^):
GGCCAAGGCGCCAGGCCGGGCTGTAGATCTGACACCTCCTGCTGCCTGGCTCTGATCAGATTCTGGCTGTGGGGCAGGTGTGAAACTGAATGCTGGAGGAGGGTTGTTCTTTGGCCTGGATATAGCTGCCGACCCT^agcccttccttagcgcaggctggccttgctcatggtgactttcttgaatcctagagcactgctgcccacccagggcactgcctgggctacagcctctgccccagtcgccagactccagggtccccagggagactcccaccaggcctgctctcaggtgagccgaccggatcggatcgggttccttcggtttcatgtcccgcattgttcttggctgggccctggc^TTATGAAACAGTAATGAGGGGCCCTGCTCCCGAGGCTGGCCCCTCTAAGGTTTCTGCTGCCTGGAACACTGCAGCCACCGCGGCCCAGAGTCGGGGCCTGGGAGGGTGGCAGCGTGGGGGCCTGAGTTGGAGCCCCCCGGG
This mutation is a 223 bp deletion beginning at Chromosome 15 position 78,957,051 bp and ending after 78,957,273 bp (GRCm38/mm10). In addition, there is a single (G) bp insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45089 | TGA AAC TGA ATG CTG GAG GA | Common | A | |||
| 45090 | TTC AAG AAA GTC ACC ATG AGC | Wild type Reverse | A | |||
| 45091 | CAG GCA GCA GAA ACC TTA GAG | Mutant Reverse | A | |||
| 45092 | Fluorophore-1 | CCT TCC TTA GCG CAG GCT | Quencher-1 | WT Probe | ||
| 45094 | Fluorophore-2 | CCG ACC CTG TTA TGA AAC AGT AAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45089 | 0.40 uM |
| 45090 | 0.40 uM |
| 45091 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.