For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:27001516+27001627 112bp GAGAATTGAGTTGGTACCGAGGA GTCTGGCTTCTGTCACAACCT
Mut= 120 bp
Wt= 112 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTCTGTTCTGTATCTATAAAAGGTCTCCAACAGGGTCGGAAGGGAATAGAGTGCCTGCCCTAGGTGGTTCACTCCCAGTGAGAAATAGTATTTGTTTCAGAAGACCCTCTGTGTACATGTGTCACGTCAGGCATTCTAAATCTCTCCTcactgaaaaatgaatggtagagttcaaaatgtatgttctctatcaccaaggcttctctctctctctctctctctctctccctctctctcccttcccccatcctctttttttttgggggggggggaatgggggagacaattcttttgtgaaaccttgaagaattccctaggaaaattcaaagcaagttactgaaatgacttttttccagaactttgtggaacataggcaatataagatggaccttcttcttctgattttagagaaaggtggcaacccacccctacatgccccagatcttcccagtgagacttcatttccttgtccagtggatcatccaaggccagaagaaagggctccgaaatatgaaaattatttttcagcctccgaaacacgctctttgaaaagagaattgagttggtaccgaggacgaaggccaagaaccgctttcacccagaaccaggtgagaagatttttcagccaatagtgacaaCACAAAGGTTGTGACAGAAGCCAGACACTCTGGGGTCCCAGTGTAGAAGTGGCATTAGTGAAAGGGTGGACTCATAGTTTAACAGTCTCTGGGCAACCAATTGTTTTAAAATGCTTTTGGATTAAAGGCCCAAATTTAAGTGCATTTTTCATTTGAAAGCCCAATT
This mutation is a 490 bp deletion beginning at Chromosome 14 position 27,001,112 bp and ending after 27,001,601 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45083 | GAG AAT TGA GTT GGT ACC GAG GA | Wild type Forward | A | |||
| 45084 | GTC TGG CTT CTG TCA CAA CCT | Common | A | |||
| 45085 | CTG CCC TAG GTG GTT CAC TC | Mutant Forward | A | |||
| 45086 | Fluorophore-1 | AGG CCA AGA ACC GCT TTC | Quencher-1 | WT Probe | ||
| 45087 | Fluorophore-2 | CAT GTG TCA CGT CAG GCA TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45083 | 0.40 uM |
| 45084 | 0.40 uM |
| 45085 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.