Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr19:58527763+58527865 103bp TGAGCAGTGTCAGATTCTTCAG CACCATGCTGTCTTCTGGTC
Mut= 98 bp
Wt= 103 bp
Fam=Mut
Hex=Wt
Mut Sequence:
tggtcacagcgattgattctttctaagttgtgagactagaagcctgctccttgaaacaagctgtttgatgtcttatgagaccagaagacagcatggtg
This mutation is a 2258 bp deletion beginning at Chromosome 19 position 58,525,572 bp and ending after 58,527,829 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45078 | TGA GCA GTG TCA GAT TCT TCA G | Wild type Forward | A | |||
| 45079 | CAC CAT GCT GTC TTC TGG TC | Common | A | |||
| 45080 | TGG TCA CAG CGA TTG ATT CT | Mutant Forward | A | |||
| 45081 | Fluorophore-1 | ACA CTG TGA ACT GAG CAT TTG ATT | Quencher-1 | WT Probe | ||
| 45082 | Fluorophore-2 | AAG CCT GCT CCT TGA AAC AA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45078 | 0.40 uM |
| 45079 | 0.40 uM |
| 45080 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.