For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:70159070+70159179 110bp TACATGCAGCTGGGTGAAG TGGCCAAGGCTACACAGAGA
Mut= 99 bp
Wt= 110 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGTAGCTTCCTTCCCTGTTCCAGCTTGGCTTCTGCAGGGACCAACATGGGCTCTGTTTGATGGCCTCCTATAGCTGGCTGCCCCTCAGCTCCACTTTACACAGTTACATGCAGCTGGGTGAAGGATTTCCcttacatgccagggttagcctctggaattggatttgaattgttgtttttttttgggacagggcttctctgtgtagccttggccatcctggaacttgctctgtagatcgggcctgcctctgcctcctgagtgctagaattaaaggccgccactaccaccaccgggctggatttgaatcataagagacaaacaatccaagacaaaacttgggctgatcttgaaaagtttattcctcaatattttgcaggcttttcccatgcttctgctcagcgctcgggagtaaaatagctgccgagtacagaaacttcacgagtaaatctttaaaggaacacattttccctccgctgatgaatatgctgatatatttaaattgcagtaagtatatactgtacataaatatccctacataaattctccCCAATAGAGAACTCATTGCTCTTACAGTCACAGCACAAGAAAAACATTTGTTACAAAACCCTGGCTAGACTCACAGGGTCAAAAACTACTGTACTGTATCTAAACTGCTATAAAATGTGTGTATGTGTGTTTGTGT
This mutation is a 416 bp deletion beginning at Chromosome 12 position 70,159,096 bp and ending after 70,159,511 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45055 | TAC ATG CAG CTG GGT GAA G | Common | A | |||
| 45056 | TGG CCA AGG CTA CAC AGA GA | Wild type Reverse | A | |||
| 45057 | TGA GTC TAG CCA GGG TTT TG | Mutant Reverse | A | |||
| 45058 | Fluorophore-1 | ACA TGC CAG GGT TAG CCT C | Quencher-1 | WT Probe | ||
| 45059 | Fluorophore-2 | CCC AAT AGA GAA CTC ATT GCT CTT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45055 | 0.40 uM |
| 45056 | 0.40 uM |
| 45057 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.