For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:63930348-63930490 143bp GCGATATTGAAAGGTGAGTGC GACTTGCCTGACCCCAAATG
Mut= 143 bp
Wt= 143 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTCTGAGAAGTCAGGACGTAGGGTGTGGGTGTGGGTGTGGGTGTGGGTGTGGGTGTGGGTGTGGGTCAAGCCTAAGAAGCTTGGGTTCTGTGTGTTGACAGCTCACATCCACAAGGTTTTAAAACATGAACACTGTAATTCTAAGTTAAGCCCGCctatgtcagataaatttggagtgtttgtcccaacttaggggcttctgcagtcctagatcagagtaacagcattggccacctgggaagtaaaccttctccgaccttcctcatctgggcctctggggactgaggaggagcgcggtgtctcacggacagcttttctaacatggctctgattgctcacttagttctttttctttctcagcgaatgcagatatcttgaaagctatggtagctgataacagcgtgggcgatattgaaaggtgagtgcctctctcccagtggatggagacagttttcatttgcttgttcagattgattccCTTGGTACTGTGTCCAGCCGGAGCTGGCCTCTAGCCTTGGGTACTATTGGCATTTGGGGTCAGGCAAGTCTTCGCTGAGAGTAATGGCTAGCACAAGATGGACTATTGAGCAGAGTCCCTCATCTCTGCTCACTGGATGACAGAGCACTTCCTCTCCTTCAAAGTG
This mutation is a 323 bp deletion beginning at Chromosome 5 position 63,930,418 bp and ending after 63,930,740 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45050 | GCG ATA TTG AAA GGT GAG TGC | Wild type Forward | A | |||
| 45051 | GAC TTG CCT GAC CCC AAA TG | Common | A | |||
| 45052 | GGG TTC TGT GTG TTG ACA GC | Mutant Forward | A | |||
| 45053 | Fluorophore-1 | CCA GTG GAT GGA GAC AGT TTT C | Quencher-1 | WT Probe | ||
| 45054 | Fluorophore-2 | AGT TAA GCC CGC CTT GGT AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45050 | 0.40 uM |
| 45051 | 0.40 uM |
| 45052 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.