For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:60046746-60046856 111bp TGCCCTCCTACAAAGGACAT CTGTACTTGGCCGTACTGGA
Mut= 111 bp
Wt= 111 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCGAATGAACCTGAATACACACATGTTGCTCTTAGCATGTGGCTCCCAGATGGGAGTCACTGGTCTCGTCACCCCATGGGAAAGTGGAATGTCCATATCAAAGATTGAATTGCAAACACATTGGAAGTGTCCCTGGTCAGgtgtgccctcctacaaaggacatgcagttggatgtcactttgctgttatttaagggttacctctttaactaaaagtcgtacttgtctttgtacttccagtacggccaagtacagcgtgttgacatttctacctcgattcctgtatgagcagattaggagagctgctaacgccttcttcctcttcattgccttattacaggtaatggtttttaaggacttaaacattgcaagctcaattatgtgcaaaatgagattctttagtaagtgcctttattggaaaagtgttagaatatttacatagtgtccttcctcaaattatcactaggggggacagacctgatcttggtataaaacaaacgtgggagGGAAGTCTTTGAAAAAAGAAGTTACAAAAGGGGAGCAGAAACTGGTTCTTGTGGGTCCTACCTTGTCATGTTTACCTTTTCTTGTTATTTTTAAAATTATTAATGCACATTCATTATATTAGACATGATATTTCACTGTGACACTTCATACATATATACCATTCATG
This mutation is a 365 bp deletion beginning at Chromosome 14 position 60,046,495 bp and ending after 60,046,859 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45038 | TGC CCT CCT ACA AAG GAC AT | Wild type Forward | A | |||
| 45039 | CTG TAC TTG GCC GTA CTG GA | Wild type Reverse | A | |||
| 45040 | CCA TGG GAA AGT GGA ATG TC | Mutant Forward | A | |||
| 45041 | CAG TTT CTG CTC CCC TTT TG | Mutant Reverse | A | |||
| 45042 | Fluorophore-1 | CAG TTG GAT GTC ACT TTG CTG T | Quencher-1 | WT Probe | ||
| 45043 | Fluorophore-2 | TGT CCC TGG TCA GGG AAG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45038 | 0.40 uM |
| 45039 | 0.40 uM |
| 45040 | 0.40 uM |
| 45041 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.