Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr2:25435759+25435858 100bp AGAGATAAGCTTGACTTCACGAG ACAGAAAAGCTGCCAAGTGC
Mut= 95 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Mut Sequence:
taaccagttggcctgagaggtcagaggtcactgctaaggggggtgcctcctgtgctttagggttagaggtgcagtggcacttggcagcttttctgt
This mutation is a 2972 bp deletion beginning at Chromosome 2 position 25,432,845 bp and ending after 25,435,816 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44878 | AGA GAT AAG CTT GAC TTC ACG AG | Wild type Forward | A | |||
| 44879 | ACA GAA AAG CTG CCA AGT GC | Common | A | |||
| 44880 | TAA CCA GTT GGC CTG AGA GG | Mutant Forward | A | |||
| 44881 | Fluorophore-1 | TCT AGG TAC TGG TGT GCC TGC | Quencher-1 | WT Probe | ||
| 44882 | Fluorophore-2 | AGA GGT CAC TGC TAA GGG GG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44878 | 0.40 uM |
| 44879 | 0.40 uM |
| 44880 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.