For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 81 bp
Wild Type = 91 bp
>chrX:72820392-72820482 91bp TGTCATTATTGTTATAGACTGCATTTG CCTTCACTCCAACGAACTCAG
Sequence
Wt Sequence:
ttgtcattattgttatagactgcatttgtatttactaaaggaCTgtCAggaatcaggaacactagaatacactgagttcgttggagtgaaggagtttgagcacgaactttattctttacttctttcttgtgttttagATCCATCACTCGCGCCTACTACAGGAATTCAGTAGGTGGTCTTCTCTTATTTGACATTACCAACCGCAGGTCCTTCCAGAATGTCCATGAGTGGTTAGAAGAGACCAAAGTACACGTTCAGCCCTACCAAATTGTATTTGTTCTGGTGGGTCACAAGTGTGACCTGGATACACAGAGGCAAGTGACTCGCCACGAGGCCGAGAAACTGGCTGCTGCATACGGCATGAAGTACATTGAGACGTCAGCCCGAGATGCCATTAATGTGGAGAAAGCCTTCACAGACCTGACAAGAGACATATATGAGCTGGTTAAAAGGGGGGAGATTACAATCCAGGAGGGTTGGGAAGGGGTGAAGAGTGGATTTGTACCAAATGTTGTTCATTCTTCAGAAGAGGTTATCAAATCAGAGAGGAGATGTTTGTGCTAGTTAACCCTTCCATTTTCAAAACATACTCTCCCACTTGAACTTAAAAGTTATCAAAATAAATAGAATCCTTATGTGACTGAAGAGAACTCAACGTTTGGATAATAAATGAGCCTTCTTCCTAGGCCTGGATCTCTGACAGGCTCATGTGTGGGTAGATAGGGAGCCTG
Mutant Sequence:
ttgtcattattgttatagactgcatttgtatttactaaaggaCaggctcTgtcAGGCTCATGTGTGGGTAGATAGGGAGCCTGGGTGCTGTGACTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44808 | TGT CAT TAT TGT TAT AGA CTG CAT TTG | Common | A | |||
| 44809 | CCT TCA CTC CAA CGA ACT CAG | Wild type Reverse | A | |||
| 44810 | Fluorophore-1 | TAA AGG ACT GTC AGG AAT CAG GAA | Quencher-1 | WT Probe | ||
| 44814 | Fluorophore-2 | ACA GGC TCT GTC AGG CTC AT | Quencher-2 | MUT Probe | ||
| 44825 | AGG CTC CCT ATC TAC CCA CA | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44808 | 0.40 uM |
| 44809 | 0.40 uM |
| 44825 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.