For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 112 bp
Wild Type = 94 bp
>chr2:129195347-129195440 94bp AGGTGAGACTCTGAGCTTGG GAGCAAGGCAGTCCCATATC
Sequence
Wt Sequence:
ATTTAGGTGTCAGAAGTCAACAGAGAGCAACCAGAGCACCCActtacctggcccagaatctgcttctagactgttacttacgtagcactgtagaacttcccagaagtctttgggaagctttaagagtcatggtaggtgtggttttatgaacaatggaagtctgtctgctcagtattgataaggagctatcacttgaccacatctgttttcattacagtgatgagaatgacctgttctttgaagttgacggaccccaaaagatgaaggtgagactctgagcttggctcctaacctgtggagggactgtggcatgggaaaaaaaaacccaAACGGGAAGGGATATGGGACTGCCTTGCTCCCAGGCTATTTTGTGATGGGA
Mutant Sequence: TGCTAGTCTAGAATTTAGGTGTCAGAAGTCAACAGAGAGCAACCAGAGCACCCaaACGGGAAGGGATATGGGACTGCCTTGCTCCCAGGCTATTTTGTGATGGGATTATTTTGCCTCTTTC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44749 | AGG TGA GAC TCT GAG CTT GG | Wild type Forward | A | |||
| 44750 | GAG CAA GGC AGT CCC ATA TC | Common | A | |||
| 44751 | Fluorophore-1 | ACC TGT GGA GGG ACT GTG G | Quencher-1 | WT Probe | ||
| 44752 | GGC AGA GAG CTC AGA CTT TAG C | Mutant Forward | A | |||
| 44753 | Fluorophore-2 | AGA GCA CCC AAA CGG GAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44749 | 0.40 uM |
| 44750 | 0.40 uM |
| 44752 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.