For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 84 bp
Wild Type = 96 bp
>chr6:3324616-3324711 96bp ACCAACTTTCTCCAAAAGAACA TCATGAACGAATAAAAGTTTTCAC
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44744 | ACC AAC TTT CTC CAA AAG AAC A | Wild type Forward | A | |||
| 44745 | TCA TGA ACG AAT AAA AGT TTT CAC | Common | A | |||
| 44746 | Fluorophore-1 | CTT TGA GGC CAA ACT ACA GGA | Quencher-1 | WT Probe | ||
| 44747 | GCA AAG TTA GCA AAT AGC ATT TCA | Mutant Forward | A | |||
| 44748 | Fluorophore-2 | AAC TTT CTC CAA GGA GCA TAA GAA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44744 | 0.40 uM |
| 44745 | 0.40 uM |
| 44747 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.