For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:134861364+134861460 97bp CTTTGTTTGACAGGACTTTTCC ACTGTTCTGCAGTCAGACATTCG
Mut= 97 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTGACACATGACTCTAGGTTACAATGTTTACAAGAGATTTGATAGGTGTGTGAAATGAAGACCTAGACATAAGGTGAAAATAAGGGCTGGTATTTGTATTGTGATTGAAAGTTCAACAAATTCCAAGTCCTGTATATTTCATCCTATAagattctttagcgtgtgtgtgtatttctctgcaggtaccacatcattgttatcatcctggtgtactgtttcccattgctcatcatgggtgtcacctacaccatcgttggaattactctctggggaggagagatcccaggagacacctgtgacaagtaccatgagcagcttaaggctaaacgaaaggtatggtcccatttaactgaccagtataactgtcccaaataactgacccctataactcacaagttggtgcagactgggccacttccaaggaggaaggcactgactgatgttagaaatatgttctcatatctcataatctgaatcctcctttgtttgacaggacttttcccttgcataacctctttgttctccctggcaaacctcagcccttggAAGGTCTGCGAATGTCTGACTGCAGAACAGTTACATCCTTAAGGATTAGCTGTTTTGTCAGTCCCTGTTGTGGCCCATTCTCAATTACTTTACCTGAAGTTCTTAAAGTGTCTCTTAAATGGAATCTAGCTGATTGTATTTCTGCA
This mutation is a 398 bp deletion beginning at Chromosome 3 position 134,861,032 bp and ending after 134,861,429 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44714 | CTT TGT TTG ACA GGA CTT TTC C | Wild type Forward | A | |||
| 44715 | ACT GTT CTG CAG TCA GAC ATT CG | Common | A | |||
| 44716 | AAG GGC TGG TAT TTG TAT TGT G | Mutant Forward | A | |||
| 44717 | Fluorophore-1 | CCC TGG CAA ACC TCA GC | Quencher-1 | WT Probe | ||
| 44718 | Fluorophore-2 | AAG TTC AAC AAA TTC CAA GTC CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44714 | 0.40 uM |
| 44715 | 0.40 uM |
| 44716 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.