Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:67329447+67329555 109bp TCAGATGACTTGGGGGTGA ATGAGCATGGGTTTAGAATGC
Mut= 98 bp
Wt= 109 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case):
GTTAAACCAAGACAACGTCCCTTGACTTTAGCTATCCTAAGATCTATCTGGCAATTCTGAAGGCCAACTACTCTTTAGCTTTACATACCAGATATTCCTTCTGGGCACACACAATGCCAGGCTGGTCTGGGAGGCACCAGACTAGAATcaggttaaccaaggggagttattgctaggtcatctccaggcacagaaatgatccattaagttgtggcaacgccctcactctgctgcagtatctcactatgccgcgcctaccccaggagagaacaggtcagtgacgctgcaccctcgccttgcttttcctcgttctacccaggagctcactctgaacagtgaccaagtcttccccatgaacccccctaagtttgacaagatcgaggacatggccatgatgacccacctgcacgagcccgctgtgctgtacaatctcaaagagcgttatgcagcctggatgatctatgtgagagccttttgacctctttctattttgctgcctctctgaggaaaaaacaagatccttaatcttttgaatttcccacagacctactcaggcctcttctgtgtcaccgtcaacccctacaagtggctgccggtgtacaaccctgaggtggtggcggcctaccgaggcaaaaagcgccaggaggccccaccccacatcttctccatctctgacaatgcctaccagttcatgctaacaggtaagtgaagcctttgatttgtatgattgtaaggcattattggcctagtgtttgggcccttatataccccacacatctaaacaatacagtagcagccagcatgaacttgggagcctcagatgacttgggggtgaatattccaagccatggcacttttattatagtagtcatggtgaagggcaaagCCAGGGGTTCTTTCTGAAGCATTCTAAACCCATGCTCATTTCTGGGGGTGGGGGTGCATTGTAGAACACAAGGACACTGCTCTTCTATATTCCCAACTTACCCTGCTATGGGTACATTTAGACGAGACTCCCCAAA
This mutation is a 738 bp deletion beginning at Chromosome 11 position 67,328,779 bp and ending after 67,329,516 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44572 | TCA GAT GAC TTG GGG GTG A | Wild type Forward | A | |||
| 44573 | ATG AGC ATG GGT TTA GAA TGC | Common | A | |||
| 44574 | AGA TAT TCC TTC TGG GCA CAC | Mutant Forward | A | |||
| 44575 | Fluorophore-1 | AGT AGT CAT GGT GAA GGG CAA A | Quencher-1 | WT Probe | ||
| 44576 | Fluorophore-2 | CTG GTC TGG GAG GCA CC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44572 | 0.40 uM |
| 44573 | 0.40 uM |
| 44574 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.