For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:31064317+31064437 121bp AAAACAGCACATGCTTATCCAC AAGCAGGATTGCAAAGCACA
Mut= 123 bp
Wt= 121 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (ACTGTAGGAACTGATGAGAGTTG insertion):
TGGACTGGGAAGAGAAAATTCCTATATGAGTAGTTTTAGACACTTTTTGTGGGAGTTGAGAATTTATTCTACAAGAAGACAGTTGTCACAGGTTTTAAAGGGTGAAATAAGGGTCTAAGTTAAAGCAGAAGAAAGGAGGGAATTAAAGAGGTGAAGGGCATCTAAAAAGC^agcctgggatctgttttgtgttttatgtccacactaaagatgctggacatttagacaattacattgctttatacatttttctaagtgaaaatctgtttttaaaagtctttgttgcttcctttgttcatttaagagttggactacagaaatgtgtattcaacttaaacatcagagcctcgttaccttctttggtttatttttttagattggaaaatgttcagtatccctatcaactctacattgctccttctaccagcagtacagagcggccaagtccaaatggtccagacagaccgtttcagtgtccaacctgtggggtccgcttcacccgtattcagaatctaaaacagcacatgcttatccactcaggtaatgtcaccttcagggttgttgtatgggggggg^GGGGCGGCACGGGGGGTTGCAGGCAGGCAGGCAAAAACGTTGTGCTTTGCAATCCTGCTTAAAATACAAAAGACTTTGTGCCAGGCCAGACATAGTGCCAAGTGCCTTTAATCCCACCACTCAAGTCTAAGGCAGGCAGATCTAGAATCTGAGGCCAGCC
This mutation is a 404 bp deletion beginning at Chromosome 9 position 31,063,974 bp and ending after 31,064,377 bp (GRCm38/mm10). In addition, there is a 23 bp insertion (ACTGTAGGAACTGATGAGAGTTG) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44535 | AAA ACA GCA CAT GCT TAT CCA C | Wild type Forward | A | |||
| 44536 | AAG CAG GAT TGC AAA GCA CA | Common | A | |||
| 44537 | GAA AGG AGG GAA TTA AAG AGG TG | Mutant Forward | A | |||
| 44538 | Fluorophore-1 | ATG TCA CCT TCA GGG TTG TTG TA | Quencher-1 | WT Probe | ||
| 44539 | Fluorophore-2 | CTC ATC AGT TCC TAC AGT GGG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44535 | 0.40 uM |
| 44536 | 0.40 uM |
| 44537 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.