For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 99 bp
Wild Type = 100 bp
>chr10:34297331+34297430 100bp CGACAAAATTACCTGGATTGC TTTTCCTTCTGGGCTGGTG
Sequence
Mut Sequence (insertions with carrots ^c^ (c insertion):
tttattagacaataggttctattttaaaatttattttgagacatggtttagatactgtcgaaattaattagagacttacgaatagacgtaaaatataattcgacatccatttatgtactcaatttcccagatgagattaaatttacagcatcatttaaaaagacaaaaagaacacacttgatcgacaaaattacctggattgccagttctcgC<c>--3982 bp del--Gttgggcaatgatgaagcatttcacttttattcacagaacaacatgaactgagcagaccaaaaatgattcttttttcctttttagccagcagatgagagactatctgaactggttttgaggctgcacagagagtaactaggggagttgggtgtggtggtacaacct
This mutation is a 3982 bp deletion beginning at Chromosome 10 position 34,297,362 bp and ending after 34,301,343 bp (GRCm38/mm10) with a single base pair insertion (C) at the deletion site
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44468 | CGA CAA AAT TAC CTG GAT TGC | Common | A | |||
| 44469 | TTT TCC TTC TGG GCT GGT G | Wild type Reverse | A | |||
| 44470 | TCA TTT TTG GTC TGC TCA GTT C | Mutant Reverse | A | |||
| 44489 | Fluorophore-1 | CGC TAC GGT TAG TTG CAG CT | Quencher-1 | WT Probe | ||
| 44490 | Fluorophore-2 | TCG CCG TTG GGC AAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44468 | 0.40 uM |
| 44469 | 0.40 uM |
| 44470 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.