For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 137 bp
Wild Type = 118 bp
>chr2:129133250-129133367 118bp GGGCTAGGTTTCTTCAAAATG TCTGTGGGCTATCTGGTTATCTC
Sequence
Wt Sequence:
tgtgtatgttcatgtactcagttactatagagcttattctcaccctaacaggaaccaagttctcctaaGGATGATGGATTAGCTCTTAGAGATCCACtaaaagtcattactgtgtttgaccgtttgaactcagtggtgcctatgcctaaatcagtttttaggaatactgtctgagttacccaaagttaatgtggctgttaagatatgacacccactgaccacagtaaaggaatggacaaaaatacagtctcattatatgttttttggcagTGAAAACGAAGACTACAGTTCTGCCATTGACCATCTCTCTCTGAATCAGgtaagtacatgattagcattcttattcatctgggttctctttttcttcctttttttccacactagttcacctaccagaaaagcacaatgagaactgagtagtacatacttatgtctcaccctcactagagatataaatacatttactctttataaatgagatcacttggttcttcatactagtagttaaatggcattcttcatgttcattggctctttcataacagagaactatctgaagccctaagaacagggctaggtttcttcaaaatgttaattttgtcctccctagccagttgcttcagcccacCTcacctggggtctgtctcctaagagactagaggctagagataaccagatagcccacagaactgaggttgaggagcctagccaagagaaagtaa
Mutant Sequence:
tgtgtgttcatgtgtgtgtatgttcatgtactcagttactatagagcttattctcaccctaacaggaaccaagttctcctaaGccacctggggtctgtctcctaagagactagaggctagagataaccagatagcccacagaactgaggttgaggagcctagccaagagaaagtaaatatgttgcacacactcacca
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44381 | GGG CTA GGT TTC TTC AAA ATG | Wild type Forward | A | |||
| 44382 | TCT GTG GGC TAT CTG GTT ATC TC | Common | A | |||
| 44383 | Fluorophore-1 | ATT TTG TCC TCC CTA GCC AGT T | Quencher-1 | WT Probe | ||
| 44384 | GTT CAT GTG TGT GTA TGT TCA TGT | Mutant Forward | A | |||
| 44385 | Fluorophore-2 | AGT TCT CCT AAG CCA CCT GGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44381 | 0.40 uM |
| 44382 | 0.40 uM |
| 44384 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.