Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chrX:9913578+9913712 135bp GGAAGACATTCCTAACAAGGGTA ACACAGGACTAGAGTAGAGAACAAAGA
Mutant= 136 bp
Wild Type = 135 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
A 544 bp deletion beginning at Chromosome X position 9,913,615 bp and ending after 9,914,158 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44366 | GGA AGA CAT TCC TAA CAA GGG TA | Common | A | |||
| 44367 | ACA CAG GAC TAG AGT AGA GAA CAA AGA | Wild type Reverse | A | |||
| 44368 | AGC TTC TAT GAA ATC CCA GCA | Mutant Reverse | A | |||
| 44369 | Fluorophore-1 | CTG AAT ATC ACA CTA ATG AAG TCA GTA GAA A | Quencher-1 | MUT Probe | ||
| 44370 | Fluorophore-2 | CCT CTC GAT TAG TTT TCC CCT | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44366 | 0.40 uM |
| 44367 | 0.40 uM |
| 44368 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.