For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:133602348-133602452 105bp GGTTAGCTCCAGAGCAGTACTCA AAACATTTTGCACCCTCATGG
Mutant= 110 bp
Wild Type = 105 bp
Sequence
Wt sequence with deletion in lower case
TGATGTGAGCAAGGTTAGCTCCAGAGCAGTACTCAGGTTAGTTTTCTGAAAACTAAGAGTTTGAAACAGatggttgccatgaggacaatgctgaatccatgagggtgcaaaatgtttgctgtgtttccagcatcttcttgtcctcacctctcaggctggttttgggacttcttcagttagaatctggaggttagaattctgcacgtgcttggggaacccaatgtaaggaacaaatggcaaaaccccctcttggggcttagaatgctctggccattgtgacatgagcttccatcccatgatagtggtgggctttctccacctctctgcccaggcaacagctgagaagatcagatacagtgggtgggggagctctacagacgtcacaagcttgtgaggccacagacagcttgtgaggcaaccccagtacattcagctcattggagagaatggccaaagggaggcgtttcaacccgtctttgaataatgacggaagatgggtaaggaaggatgcattcctgaaagcttcctcatgaaatgtggctgttgttgagggcacagatctgggctggattcccttctgctgcctctggtagcttgacctttgaaaagactctgggccttggtcttttcacctgtcaagAGGGAAGCTCAATATTCTTTTGAGGATTCAGTGAACACACATGAATCTGAGGGAGGCAGTCCAAGCCTGTAATCTAAGTACTTGAAAGGCTGAGGCAGGAGGATT
A 571 bp deletion beginning at Chromosome 7 position 133,601,825 bp and ending after 133,602,395 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44361 | GGT TAG CTC CAG AGC AGT ACT CA | Common | A | |||
| 44362 | AAA CAT TTT GCA CCC TCA TGG | Wild type Reverse | A | |||
| 44363 | CCC TCA GAT TCA TGT GTG TTC A | Mutant Reverse | A | |||
| 44364 | Fluorophore-1 | TGG TTG CCA TGA GGA CAA T | Quencher-1 | WT Probe | ||
| 44365 | Fluorophore-2 | GAA ACA GAG GGA AGC TCA ATA TTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44361 | 0.40 uM |
| 44362 | 0.40 uM |
| 44363 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.