For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:4232328+4232420 93bp TCCGATGAGCTGTCTGTCTG TGCCCTACCCTGGACTTAGA
Mutant= 106 bp
Wild Type = 93 bp
Sequence
TTGGCTAAAAAGGGAAGCTAGCATGTCTCGCACTTCCGATGAGCTGTCTGTCTGCTGGATGGCAAAGgcaaatgggtggggagattgccaggatatagagtcacagctctaagtccagggtagggcaaaggcctggatgtgcctgaggagccaccacatgttattgcaggggaagacACCCAgtccctcagccaggaggaaacagagctggagctgctgaggcagtttgacctggcctggcagtatgggccttgtacaggtgagcaccccatttccagtccctcccatcaggcacatctctgaatcagttctgttatcaatgtgtctcaaaagtaatcctgcctagctcttggacactgtctcctgaaactgactatggaggctcaagaaactgccgtccatgtccactatcctggattctcctgcctatcctgtcttcttttcctgatggcaggtatcacaaggctgcagcgctggagtcgggcagagcagatgggcttgaagccccccctagaggtgtaccaagtgttgaaggcacaccctgaagaccctcacttccaatgcaggtcaggataggctgggacagctttcaggggaaccagggacttctccaggagctgccaccctcTTGGTCTACGTAGGGGCTACCTTGACTTGGAGAAGTGGGAACAGACTTAGACGGTCCTTCCTGTCAAGCAAGAAGAGTCTGGCT
A 2-part deletion beginning at Chromosome 19 position 4,232,361 bp for 446 bp, followed by 5 bp of retained sequence (TGGGT), then an additional 110 bp deletion that ends after 4,232,921 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44356 | TCC GAT GAG CTG TCT GTC TG | Common | A | |||
| 44357 | TGC CCT ACC CTG GAC TTA GA | Wild type Reverse | A | |||
| 44358 | CTT GAC AGG AAG GAC CGT CT | Mutant Reverse | A | |||
| 44359 | Fluorophore-1 | AGA TTG CCA GGA TAT AGA GTC ACA G | Quencher-1 | WT Probe | ||
| 44360 | Fluorophore-2 | AGA CCC ATT GGT CTA CGT AGG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44356 | 0.40 uM |
| 44357 | 0.40 uM |
| 44358 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.