For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:59071655+59071752 98bp AGGATAAAGCTAGGCCTCTACC GTTGGTGGCTCAAGGCATCT
Mut= 90 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAAACTGCTTCCACGATGGAACACAGTGTTTGAGGAAACCTAAATCTGTGTTCCCAGGCCATAGCCGTCTAAATTGGCTTACAGAACCTTTCATATAATTTTCATTTCCACACACTAATAATTAGTCCAGGTTCTAAGGATAAAGCTAGGCCTCTACCCGACAGGGTCTCCTCCCATgttgaccttgggatggtacttagaaggggcccttgaaagatgccttgagccaccaacctcaatgcaacaggatagcatatgtgattcctagccaaggaagtaaggcgtgaggactgggaagatggaggctttgacaccgagggaatggatacccgtggctgctgggggcctactgaaccacttgttccttaagtgagacctttcttctactcactcacgtatcctcttgtgtcttttcaggactcctcttccgctggacctgtccccacagccctcccacgagctgctgcagtggctggagaacagggcatgtctcccaaagtccagctgcccctcaacgtgtgagctgcccctcatgtctGTCGACATTCTCTGCACACTGGCATTTACACAAGTGGTTCCTAGTGGGTTTTTCAGTTGGTTACTAGCTGTTCTTTGTAGTCGCACTTGTGTGTCGATGCTTCCCTGAAGGGGAGTGTGAAAAGTCTCTTAACGCTGCTGTCCCTAGGATAATTAGGAGAAGTGAGGGAAGACTAATCACACTGGACAGCA
This mutation is a 361 bp deletion beginning at Chromosome 10 position 59,071,696 bp and ending after 59,072,056 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44157 | AGG ATA AAG CTA GGC CTC TAC C | Common | A | |||
| 44158 | GTT GGT GGC TCA AGG CAT CT | Wild type Reverse | A | |||
| 44159 | ACC CAC TAG GAA CCA CTT GTG T | Mutant Reverse | A | |||
| 44160 | Fluorophore-1 | ACT TAG AAG GGG CCC TTG AA | Quencher-1 | WT Probe | ||
| 44161 | Fluorophore-2 | CCA TGT CGA CAT TCT CTG CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44157 | 0.40 uM |
| 44158 | 0.40 uM |
| 44159 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.