For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:29674341+29674441 101bp GAAGAGGGCCAGGGTGTACT AAATAAACAGCCAGAAAGAGAA
Mut= 102 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TATCATCTCTGTTTGATAGTAGATAGAACTGAAAGTGAGGTAAGGAAATGGTTATGTGTGCGTTCCTGTTCTGTGGCTTGTTTCATGTCATCAGGAACGTTGATGACATATACGTACGTATACAGCTGGCAAGAGTAGAGACGTCACTGTGACCTCCATTGAGTGCAGGACCCAcactagacataggtgggacatgtggactgtgggtgcatgaggcagtcctgtcatccggacccacctaacgcttctcttcttcttccccagcatctgctacaagcctcagtggatctgacagtgagaccgaggggaagcagccctgctctgatgatttcaaagatgccttcaaagcagattcccttgtggagggaacatcgtcccgatattccatgtataacagtgtttcccagaggcttatggtatgtcttggcttagaatggacttctaaagttgcccaaaagagggagaggaagagggccagggtgtactggtgttggggagtggggtggggcacaagttagCACAGGATATAGGTTCTGAGTATTTTTTTCTCTTTCTGGCTGTTTATTTATTTATTTTGGTTTTTCTTTTTTCTTTTCCTTTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTCTTTTTGTTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTAGCTCTCC
This mutation is a 344 bp deletion beginning at Chromosome 17 position 29,674,049 bp and ending after 29,674,392 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44121 | GAA GAG GGC CAG GGT GTA CT | Wild type Forward | A | |||
| 44122 | AAA TAA ACA GCC AGA AAG AGA A | Common | A | |||
| 44123 | ACA GCT GGC AAG AGT AGA GA | Mutant Forward | A | |||
| 44124 | Fluorophore-1 | TGG GGT GGG GCA CAA | Quencher-1 | WT Probe | ||
| 44125 | Fluorophore-2 | TGC AGG ACC CAC ACA GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44121 | 0.40 uM |
| 44122 | 0.40 uM |
| 44123 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.