For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:84693392+84693500 109bp CTTCCCCGGATGTTTCTAGC AGTGAAGAAGGACCCCAGCTC
Mut= 115 bp
Wt= 109 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (A insertion):
GTTTGGTCGCATTGGGACCCTCAGACTTCTCTTCTGTGAGATGCATAGTGAGCCAGCCACTCTGTGGGTCACAGAGGGAAAATAATCTCTTGGGCCACTTGTATTGCTGTGCTGAGCAGGTTGGTCCCTGGCTTCCCCGGATGTTTCTAGCCCTCACCAG^tactgtaggatctcaacttgtccccatctgccctcccccacaggcagctgctgaagacggagctggggtccttcttcactgagtacctgcaggtacgtgggccttgccacagaggaaggcttgctctgtctctcaaaagaggtctctatagttctgtgacctgtgacagcccgggcaggctctaggctggcctctcggggtgggtggggttttgactgcttggcaggagggtgggtctcatgtcttggctgcttgttggcgggctcctggtgggtcctgtaagccaaaccctcctgaaagagctacaggtcagtgatggcgcctctgttggctttcagaaccagctgctcacgaagggcatggtgattcttcgtgacaagattcgcttctacgaaggtgagtcttactcggagctgagtgtggccagcctggctgtgatgtggtgtggttgatgttctgggacagtggcgtggcagatgct^GGGAGGCAACGGCGGCTCTCTGGTTAAGATGGCCGGAAAGGAAGGGAACAGCATTGGGCAGCGGGACTGAGGTCTGGACTGGGAGGGGACCTTGGAGAGAGTCTGCACCCACCCCCTTGGGAGCCCAGGAGGGCTGCGCAACCTAGGGAG
This mutation is a 481 bp deletion beginning at Chromosome 15 position 84,693,421 bp and ending after 84,693,901 bp (GRCm38/mm10). There is also a single bp (A) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44021 | CTT CCC CGG ATG TTT CTA GC | Common | A | |||
| 44022 | AGT GAA GAA GGA CCC CAG CTC | Wild type Reverse | A | |||
| 44023 | CTC CCA GTC CAG ACC TCA GT | Mutant Reverse | A | |||
| 44024 | Fluorophore-1 | TGT AGG ATC TCA ACT TGT CCC C | Quencher-1 | WT Probe | ||
| 44025 | Fluorophore-2 | AGA GGG AGG CAA CGG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44021 | 0.40 uM |
| 44022 | 0.40 uM |
| 44023 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.