For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:134918843-134918938 96bp ACATAAAGGCCGACCTCACC GAAGCACACATGCAAACGAG
Mut= 93 bp
Wt= 96 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TATCAAACGAAAACCAAGTGTATCCCACATGGAAAAAGTAAGCAGGCTTTAATATCGAGAAGCAGTTCACGCTGTGCCTGCCAGCAACTCCCCGCCTGTCTGATTTTCCTTAACATAAAGGCCGACCTCACCTGTTTAAAAATAATTAGGAAGCCAGCAGctgtgatttggctggacgtccattcggcctcgtttgcatgtgtgcttctgacccactgatgcctctgttgctgtctctgcatgcaggcaccatggtcagcaaggactctggcagatgcatactcacgacaccagagcgggaagtggagcccgccgcctgcctggccctggagatgagatatgccctcgaccctaaccggcagatcaaaaagcgaaacaaagctctgcaggtgcgttttaaggatatctgtgaggcccagaatgagcagagagacacacagctgtcttcgggacctctgggggagaagcgagaggccaaggctgtgtcctgcagggtggcctatcgtaagtatatgacagtgcctgcacgccgatccattcccaatgtcaccaagagcaccggtgtgcagacctcaccagatcttcgcaagtgttaccagacattcccgctggaccgcaagaaaggcagtctcaaaggcctgccggctgcagatgccttcaaaagccagaacaatgggtttctagcagattcaaaagagaagagcgaggcgggacccatggaggagcctcggccttgcagtgcaggaaggattcacaagaccaccgcattggttttccattccaatgagcacgtgaacgcactgggacagccttctggggtcaactgtgcagagctctgtaagtctccagatgtgcttggctacccagaggctgttttgcaaaactctcggcctccctctgaggagcccatccaccagctgcaggggagagctaagcttgacaggggcaccctggactcagaggagccggctccactcacccacggaagggtgtttaaaaccgaggtcgccactgtgtatccgcctgccatcagtaccagggcccctgagcctggcttgtcaaactctgctgctgccagccagtggtctctctgccctgcagatgaggagcagaggcgagccgcccacctcaatgggctacaggcatccacaggctctgctgtggcctgctcaaccccggtgcagtacctgtccccagaatgtagcgaacagcccctgcagaaccagcctagccccacagctgggataggggatgaagaacaccaacaaattgtgcctcacacagaggtggtagacctcaaggcccagctgcaggtgatggagaacttaatcagctctagccaggagaccatcaaagtgctgctgggagttattcaggagctggagaaaggagaagcccatcgggaagggtatgtatggccactgcatcttaccccctgtgggctcaccacttgcaggcccatcagcagccccgatgtcccagccctaaggagtctaatgccggtggtttttgtgtcagggctgcagtctgacaagggtcacagGTGTGTTGAAGGCCAGGCTTCCTGGCACACTCGCCTCTGATACTCATTCGTTGGTTAGCATTTACCCATCTGGCCTTGGGTTTCAATCTCTCCCTGTCTATTCAGGGAGCTGATGGGTCTTCCTTGTGATCTTTTCAGATTGATGTTTTCTA
This mutation is a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43723 | ACA TAA AGG CCG ACC TCA CC | Common | A | |||
| 43724 | GAA GCA CAC ATG CAA ACG AG | Wild type Reverse | A | |||
| 43725 | GAG TAT CAG AGG CGA GTG TGC | Mutant Reverse | A | |||
| 43726 | Fluorophore-1 | ATT TGG CTG GAC GTC CAT T | Quencher-1 | WT Probe | ||
| 43727 | Fluorophore-2 | CCA GCA GGT GTG TTG AAG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43723 | 0.40 uM |
| 43724 | 0.40 uM |
| 43725 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.