Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:113703640-113703758 119bp CCTTGTTTGGCAGTTGCAG TGCGTTAGGGGTGAGCTTG
Mut= 120 bp
Wt= 119 bp
Fam=Mut
Hex=Wt
Mut Sequence:
ccttgtttggcagttgcaggcggcccgtgcctccaaggctgcctccttgtagaaatgcagctgaccaaggtccacagggcctgattgggggtcggtggggagggtacatgcctgcaatcc
This mutation is a 3917 bp deletion beginning at Chromosome 11 position 113,699,772 bp and ending after 113,703,688 bp (GRCm38/mm10). In addition, there is a 2 bp (TC) insertion at the deletion site.
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43571 | CCT TGT TTG GCA GTT GCA G | Common | A | |||
| 43572 | TGC GTT AGG GGT GAG CTT G | Wild type Reverse | A | |||
| 43573 | GGA TTG CAG GCA TGT ACC | Mutant Reverse | A | |||
| 43574 | Fluorophore-1 | TCA CCG CAT AGA CAC AGC C | Quencher-1 | WT Probe | ||
| 43575 | Fluorophore-2 | AGG TCC ACA GGG CCT GA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43571 | 0.40 uM |
| 43572 | 0.40 uM |
| 43573 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.