For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:32905609+32905732 124bp AAAGCCCTCGTCTGGAGTG ACAGAAACCTGGGGAATCAG
Mut= 118 bp
Wt= 124 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGGTGTGGTTTTCTGTGACGGCCACTCACCAGCTTCCTGTCAGGAATGGGTACCTACCTCATACAGGCAGCTCATGACCAAAGCCCTCGTCTGGAGTGCGAGAGAATAAGGTGACcagccccggtttgtgtgaaaggatatttgtgctttgtgtggacggtttttcaggcgggacttgcaggcctgattccccaggtttctgtggcaacctcacactctcatgcatccttcccttgcagagaaaaccgagaagatcctcacagagttccttcgcttctatgaggaccagtatggtgtctccctcttcaatagcatgcgccatgagatcgagggcaccgggccaccgcaggcacagctgctctggcgcaaggtgagaggcatagagagggtccagcctgggctctgtaccccttctgctatgggcctttgtcttctctgggccttagtttccctatgctgctggtttggtctctaagggccttcataggttgaggataaccaccccacacttgcttcttagtctccactaccagtgccacccctaccccactgccagtgttacctaccctcactgccagtgctacccccccactgccagtgtcacccctctcccactgccagtgccacccacccccactgccagtgtcacccctctcccactgccagtgccacctctaccccactgccagtgccacccctccctcactaccagtgtcacccctccctcactgccagtgccacCCACCCCCACTGCCAGTGCAACCTCTCCCCCAATCCCAGTGCAACCCCTCCCCCAATGCCAGTGCAACCTCTTCATTGTCACAGCTACATTCTGCAGTCTTGACAGCTCAGGCCACACACCTGTCAAGAGAGAT
This mutation is a 626 bp deletion beginning at Chromosome 2 position 32,905,645 bp and ending after 32,906,270 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43508 | AAA GCC CTC GTC TGG AGT G | Common | A | |||
| 43509 | ACA GAA ACC TGG GGA ATC AG | Wild type Reverse | A | |||
| 43510 | GTG ACA ATG AAG AGG TTG CAC | Mutant Reverse | A | |||
| 43511 | Fluorophore-1 | CCC GGT TTG TGT GAA AGG | Quencher-1 | WT Probe | ||
| 43512 | Fluorophore-2 | AGG TGA CCC ACC CCC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43508 | 0.40 uM |
| 43509 | 0.40 uM |
| 43510 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.