Protocol 34390: QPCR Assay - Large1<vls>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mouse wt Exon 3 (Large1) =   88 bp

IPC = 74 bp

>chr8:73131860-73131947 88bp CACTCCAAGACCTACTCCATG CACACTCAGAGCTGTTACCTG

Plese note this is a qPCR for  the deleted region so mouse wt will have two copies (hom-like); hets will have one copy (tg/o-like) and hom will have no copies (wt-like)

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
43488 CAC TCC AAG ACC TAC TCC ATG Forward A Exon 3
43489 CAC ACT CAG AGC TGT TAC CTG Reverse A Exon 3
43490 Fluorophore-1 ATT CTC ACT GTC CCC TGT CCC CT Quencher-1 Exon 3
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
ddH2O
Kapa Probe Fast QPCR 1.00 X
43488 0.40 uM
43489 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.