For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:26592461+26592569 109bp TCTCTTGAATCTTGTGCATTGA TGAAGTGCTGAGCTAAAACTGA
Mut= 93 bp
Wt= 109 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAGTTTCACCATGTTTTCTGGGCTGGCCTTGAACTATGGGACTCAAGGTAGTCTCTTGATATAGCTTTACAAGTATCTGTGACTACAGATGACACCACAGCCTTAACTATGATTTCTAAAAAACTTTTTGGCCATAGccaactagaattttcggcatacccactatatgctaacgtaacttaacttctttcttccaggtgatatatcctcagcattccaaacttactgataaagaagtaagtaagcacgtctgtctgtctgtctgtctgtctgtctgtctgtctgctgtctgtcacctatgctcgttcctcgtgcagtgtgtgtgtgccggcaccgacggctctgcttttctctttcagaaaaccaatatttgctacttgtcttttccagactcaaattcaggtaactttttatcataagatgtttctcttgaatcttgtgcattgaatatcatatggtttgtagttttcgtacatgacgagtagccagCACGGCATGTTAAGATGGCATGCTCAGTTTTAGCTCAGCACTTCATTGATTCTGAGTTTTCTTAATGACGCCTAGTCCTGTCCTTACTGATTTCACTTAAGGTCACTGTTACAGTGTGATAAGGTAAAATATAAAAAGTACAATACATTC
This mitation is a 352 bp deletion beginning at Chromosome 14 position 26,592,173 bp and ending after 26,592,524 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43406 | TCT CTT GAA TCT TGT GCA TTG A | Wild type Forward | A | |||
| 43407 | TGA AGT GCT GAG CTA AAA CTG A | Common | A | |||
| 43408 | TGA CAC CAC AGC CTT AAC TAT G | Mutant Forward | A | |||
| 43409 | Fluorophore-1 | TTC GTA CAT GAC GAG TAG CCA G | Quencher-1 | WT Probe | ||
| 43410 | Fluorophore-2 | TTG GCC ATA GCA CGG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43406 | 0.40 uM |
| 43407 | 0.40 uM |
| 43408 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.