For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:104430159-104430251 93bp TCATTTCATGCCGCTGCT GCCTTAAGCAAACTGCTCTCAC
Mut= 90 bp
Wt= 93 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCCACAGCACTATTCTTAAAACCAGAACACTGAAAGCCTGTTTAGGTTGGATGAAGCTGAAGGTGTCATGTGCCCATGCAGCTCACAGCTCAGTAGACAGAAGAGCTGGTGTTTGCATCATAGTCCCTAAACCCTAAAGCTGCAACCTCtgccatgcatagatgcttttgtttatatttattattacctttttatccccttaatttgctaagcctaagatgtgtttctatttgcgtctgtataatttttttcttttccctctgtagttatgaaagagtttcaagattatatcgagcctgaagaaggttgtcagggttccccacagagaagagggcctctgacctcaggctcagacgaagacagtgttgccctccctctgggtgacaacgtgctgactcataacctggggatcccagtgttggtggtgtgcacaaaggtacgtccagggaattgtgagcttggctgggtttgcccagtgaacaagaaagagttttagaagcttcgatggagtttcttctcaagggaaaattgggcttattcaggattcatcaaggtatagtgaatgtgtcagggtaggacattctgtcatttcatgccgctgctgaattgacagtacctagttcagaaagccctgttgacTTCATGGGCAAACTCAAGTGAGAGCAGTTTGCTTAAGGCTCTAGTTTATCTGGTCCAGACTGGTGGTGACATAGAATAATGAAGTAGAAATAGAAATTAAGCTTCATTTTAGAGAAAGTATGTCTCTTATAAGAGGGGGAAGGTAGCTTTAAAAACATCCTGGATTTC
This mutation is a 490 bp deletion beginning at Chromosome 8 position 104,430,198 bp and ending after 104,430,687 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43381 | TCA TTT CAT GCC GCT GCT | Wild type Forward | A | |||
| 43382 | GCC TTA AGC AAA CTG CTC TCA C | Common | A | |||
| 43383 | AGA AGA GCT GGT GTT TGC ATC | Mutant Forward | A | |||
| 43384 | Fluorophore-1 | CAG TAC CTA GTT CAG AAA GCC CTG | Quencher-1 | WT Probe | ||
| 43385 | Fluorophore-2 | AAG CTG CAA CCT CTT CAT GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43381 | 0.40 uM |
| 43382 | 0.40 uM |
| 43383 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.