For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:78263023+78263123 101bp GAGCTACTTGGAGGACTCTGC CGGCCTCTTGAGAAACAAG
Mut= 102 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCGTAGTTCTGGTTGTTGTGCCTAAATGAGTATGACTAGAGAAATATTTTAGGAAAATCGTAAAGTTCCTAAGAAAAATCCGGCTTCAGGATACCACCCCTTGCAAGGCCTTTCTAGAATCAAAAAGGgtagagggtcttataatccaactgttttttttctgcaggtggcttgtggtccggttggccaccaggtggtgtcagcgcaagttgcaggcagagctaaagattggctccttccgatttttttggatccagaatgtcagtcttaagtttcagcagcaccagcagacggtggtgagttccgggaattgcagagagaaagagagagagagagagagaggagaagggcgggagtgtgtggtgtgtgtgttggtttggagggggtttcaaactttagcttcctccatgggtagttttcctagttaactccacccttgttgttgttgtttttgttgttgttattattattattgtcaagaggatcttaggagctacttggaggactctgcaatagatgccagttgtttcaagtgtttatggGACTAGATCTGGTGGTATAAACCTGTAATTCTTGTTTCTCAAGAGGCCGAAGCAAGAGAATTATAAATTCAAGCTCTGCCTAGGCAACTTAGTGAGTGCTTCTCTCAAAATTAAAATGAGCTGGAATAGTGGTTCAGTGGTA
This mutation is a 414 bp deletion beginning at Chromosome 11 position 78,262,661 bp and ending after 78,263,074 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43348 | GAG CTA CTT GGA GGA CTC TGC | Wild type Forward | A | |||
| 43349 | CGG CCT CTT GAG AAA CAA G | Common | A | |||
| 43350 | AAA TCC GGC TTC AGG ATA CC | Mutant Forward | A | |||
| 43351 | Fluorophore-1 | AAT AGA TGC CAG TTG TTT CAA GTG T | Quencher-1 | WT Probe | ||
| 43352 | Fluorophore-2 | AGA ATC AAA AAG GGA CTA GAT CTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43348 | 0.40 uM |
| 43349 | 0.40 uM |
| 43350 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.