For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:130035050+130035150 101bp CCTGATGGAGCTTGGAGTGA GGGATTTTCGGCAGAGTACC
Mut= 110 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGGGGTTCAGTGCTGTCTTCAGGCTTCTGTGCACACTTAGGCATAAACACACCAGACATACGCATCCGCACACCTGTGTAGTACATTCATATACTCTCATAGGCACAAGCATACACATAAGTAATATTAAAAAAAAAAGGAAAGTTGTCTCTATCTGAAATTGctaaccagggcagaacttaaggcatttctagtttaggttgttcctgagcgagtgagaaagctgggattaactagagggttcatttgtggacacttaaccttgaaatggatgtgaactgatgacggctctctgttcttttgtaggaaggatgcgaacgcagcactgctcagcaactatgaggtgaggacccccacgcgggccattgtgttttcctctctggtttagctttgcttttgaagacgttggattggttttctttagaaacgagagggcaggtggcccctgatggagcttggagtgatatgagtttggtgaactacacatggttcttcagggaagCGGGGAGGCTCTGGTTCACAATAGGTACTCTGCCGAAAATCCCAGAGTCTCTAGAGCAGGCAGATGTCCTAGCAGAAGGCTGCTGCTTTAGAGCGCAGTCCTGCTGTAAAAGTCTCCTATTAAATGCGTAGCTTCTTGATAATAACCATTCTCTACTTGTCTTTGATTCT
This mutation is a 339 bp deletion beginning at Chromosome 5 position 130,034,769 bp and ending after 130,035,107 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43037 | CCT GAT GGA GCT TGG AGT GA | Wild type Forward | A | |||
| 43038 | GGG ATT TTC GGC AGA GTA CC | Common | A | |||
| 43039 | TCA TAG GCA CAA GCA TAC ACA | Mutant Forward | A | |||
| 43040 | Fluorophore-1 | CTA CAC ATG GTT CTT CAG GGA AG | Quencher-1 | WT Probe | ||
| 43041 | Fluorophore-2 | CTC TAT CTG AAA TTG CGG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43037 | 0.40 uM |
| 43038 | 0.40 uM |
| 43039 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.