For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:22711543+22711667 125bp AAACTCGAACCCCTTTATCTCC AGGCTGCTTGTCATTGTGA
Mut= 115 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTTTGTTTAAACTACATTTAATAAAAATCAAGTAATTTCAAAATTGCCAATAACTTAGAATTTCAACAAAACCTTTAAAACTCGAACCCCTTTATCTCCTTTTCTCTAAAGGAAATGGGCCCTTTTCCTTACatttctgatttcacataagacattttcttcaagtagggacacatataactgtcacaatgacaagcagcctcaggcagctttgcccatctccctaattgtcaatctctattctagtatgtccgagtatcttttgatacgaaacctgatctcttgctacacctgatgaccaaggaatggcaactggagcttcccaaacttctcatctccgtgcacggagggctgcagaactttgaactccagcccaaactcaagcaagtcttcgggaaggggctcatcaaagcagccatgacaactggagcctggatcttcactggaggggtcaacacaggtaatcagagtaggatggagaaaggcagctgcaaccacattgtatccagaataattttgcctcaggttgaaaacgcccatacttctctacctcacctctACTCATATGTGCCCGCCCTCCTGCTCACCAACCTCCTCTTATTGCTTCTTCTCCTTCCTGTGCCTTAGTGAGAGCTATGCAGATATGTTTCAGCTAAGAAGAACTGCATATGAGGAATGG
This mutation is a 427 bp deletion beginning at Chromosome 19 position 22,711,598 bp and ending after 22,712,024 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42939 | AAA CTC GAA CCC CTT TAT CTC C | Common | A | |||
| 42940 | AGG CTG CTT GTC ATT GTG A | Wild type Reverse | A | |||
| 42941 | CAG GAA GGA GAA GAA GCA ATA AG | Mutant Reverse | A | |||
| 42942 | Fluorophore-1 | AAG ACA TTT TCT TCA AGT AGG GAC AC | Quencher-1 | WT Probe | ||
| 42943 | Fluorophore-2 | CCT TAC ACT CAT ATG TGC CCG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42939 | 0.40 uM |
| 42940 | 0.40 uM |
| 42941 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.