For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:99231903-99231996 94bp CCTGAAAACTCTACTCTCTTTAATCC GGAAAGACTGTATGTACTTGGCACT
Mut= 83 bp
Wt= 94 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTGGACAGTTAAAAGTAACCAGCAGACCCTTCTTTGGAAGTGAGGGTCTGAGGGCACAGGCCTCCCAGGATAACATCATTTCAGAGAAACTTCAGTTCTTGGGAGGGAAGGAAGGACACGTTTGGGAGCGCATCCATgcgcattcacaggcttatctgtccacgttgcttccactgtagagttgctacagcgaacggaagaaaacacggaacttggaggcgtacgtagaatggtttaatcgtctaagctacttggttgctacagaaatctgcatggtgagacaacacattgttttttcctcagatccagttttcctgctttatcttctatctgttgggcctgtgtgctgggttcctgtctgctcacgctcgtttttcttacagcctgtgaagaagaagcaccgagcgaggatgatcgagtatttcatcgatgtggctcgagagtgtttcaacattggaaacttcaattctttgatggcaatcatctgtgagtattcgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtataaacactagttttatggggcttggaaattgtatccactgaaaatctgcctttcctgaaaactctactctctttaatccagagttattatgaaacgttcagaatgctttatGGACCTAAACTAGTGCCAAGTACATACAGTCTTTCCTTAAAGGACATTCATTGAATGTCTTTAGTTCATCTATGCTCAGTTAAATATCCATCTGTAAAAGCTGAGAACTGAAACACTTGTCTAAATACAAGGTTTCTAGAGGTAT
This mutation is a 501 bp deletion beginning at Chromosome 5 position 99,231,939 bp and ending after 99,232,439 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42929 | CCT GAA AAC TCT ACT CTC TTT AAT CC | Wild type Forward | A | |||
| 42930 | GGA AAG ACT GTA TGT ACT TGG CAC T | Common | A | |||
| 42931 | TTC AGT TCT TGG GAG GGA AG | Mutant Forward | A | |||
| 42932 | Fluorophore-1 | AGA GTT ATT ATG AAA CGT TCA GAA TGC | Quencher-1 | WT Probe | ||
| 42933 | Fluorophore-2 | AGC GCA TCC ATG GAC CTA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42929 | 0.40 uM |
| 42930 | 0.40 uM |
| 42931 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.