For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:101138886+101139008 123bp GAGCATATGAGCCATAGAATCTGA ACAGGAAACCACACCAGCA
Mut= 120 bp
Wt= 123 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATTCTAGAGACAGGAATTTTGCTGTATTACCTAATTCTAAACTTATGGGCAATTCTCCTGCCTCTTGCTCCTGAGTAGCTGGGACTGTATGCATACACCTTTGTGCCCAGCCATAAGTATTAAAATATGAGCATATGAGCCATAGAATCTGAAACAAAGTATATTCCTACATAACAGcttccaggggccttgtacttgttactgcaactgctgtgaaaaacggcagagactatgctggtgtggtttcctgtgttctgagctcataaagaggaatacacccccctccatatatcttactaggcatatatcttactaggcagtagctgtattgataaatttacatggggttttaaagttctgctcttgatgataaatttttgtttgtatttctaggactttcagtcagaagaaggctgctattgaaagagagtatgcacaggtgagtgtgggaattgcaatttctgtCTTAGGTATGCCTTTTCTTGGCTTAAGATCATGTCTCCTGTCAAAGAGAATCTTGGAATCTTCTTTGGCTGCCTGCCCATTTCTGACCATCTAGCCTTTGGTTTCCTTAAAAACAAATTTTTTTTTGGTTGTTTGGCACAAGGCTTCTCTATGGCTTGACTGCTCTGAAATTTGATCTG
This mutation is a 288 bp deletion beginning at Chromosome 7 position 101,138,935 bp and ending after 101,139,222 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42914 | GAG CAT ATG AGC CAT AGA ATC TGA | Common | A | |||
| 42915 | ACA GGA AAC CAC ACC AGC A | Wild type Reverse | A | |||
| 42916 | CAG CCA AAG AAG ATT CCA AGA | Mutant Reverse | A | |||
| 42917 | Fluorophore-1 | CTG TGA AAA ACG GCA GAG ACT A | Quencher-1 | WT Probe | ||
| 42918 | Fluorophore-2 | CCT ACA TAA CAG CTT AGG TAT GCC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42914 | 0.40 uM |
| 42915 | 0.40 uM |
| 42916 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.