For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:136229606+136229692 87bp AGGGAGCTGTTGTGAAAGGA GCTGCAATACCCTTGTCCAC
Mut= 104 bp
Wt= 87 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ACTGCACCTGACTGGTTCTTGGCAACCCTGGGGAGAAGCTGGAGTGGGCTGAGCTTTGGGAAGGGAGTTGGGTAGGTGTGTTAGTGTCAGCTGGACAACAAGACTCAAGAGTGAGGTTCCCCCTGAAGGCAGCAGAGTGTCCTGTTTATCCCAGGGCCCctgctaccctttgggcaactcattcttttctcaactccaggattccaaaaagcatctggagaaggcgtggaaagactacgaaagcaaagtgtgagtgaccttggacgggtggccttcaggagagcacgtctgctctacattgaagaaggaggctgattttgggatgtgtcacttggggtgtctggctctttggagcctattgtcaggcctggctgggttctgggggccatgttgcaagatgaccaaagggagctgttgtgaaaggaccaggggatgctgcccCCTGGCCACCTTCTGGCCTTGTGATGTCCATGTGGACAAGGGTATTGCAGCCTCAAGATAACACAGCCCTGGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCACCAACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCC
This mutation is a 282 bp deletion beginning at Chromosome 4 position 136,229,360 bp and ending after 136,229,641 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42909 | AGG GAG CTG TTG TGA AAG GA | Wild type Forward | A | |||
| 42910 | GCT GCA ATA CCC TTG TCC AC | Common | A | |||
| 42911 | AAG AGT GAG GTT CCC CCT GA | Mutant Forward | A | |||
| 42912 | Fluorophore-1 | CCA GGG GAT GCT GCC | Quencher-1 | WT Probe | ||
| 42913 | Fluorophore-2 | TTT ATC CCA GGG CCC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42909 | 0.40 uM |
| 42910 | 0.40 uM |
| 42911 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.